the vest system, model 105 | hillrom

the vest system, model 105 | hillrom

Widely recognized as the gold standard in High Frequency Chest Wall Oscillation (HFCWO) therapy, The Vest Airway Clearance System has been prescribed by more physicians than any other HFCWO device. It is designed to help patients mobilize retained secretionshelping them avoid respiratory infections, hospitalizations and reduced lung function.

And it works with the Hillrom Connex App and Health Portal to help patients and care teams share therapy session data and results. With this powerful connection, patients can manage their daily care routines and clinicians can create more informed care plans.

The Vest Airway Clearance System uses HFCWO technology to help clear patients airways. It dislodges mucus from the bronchial walls, and helps move secretions and mucus from smaller to larger airways, where it can be coughed or suctioned out.

The Hillrom Connex App and Health Portal help patients and clinicians clearly see day-to-day therapy results, so they can make better decisions together. The app also helps patients keep track of everything from medications and Pulmonary Function Tests (PFTs) to nutrition, exercise and morerewarding healthy behaviors and empowering them to feel their best. Now using the Smart One Spirometer, patients can also track lung health at home using the Connex App.

owoto.com - travel brand name for sale

owoto.com - travel brand name for sale

We will email you an invoice immediately with instructions on how to pay. This domain will not be secured until we receive payment.

This domain was first registered in June 2005. Older domains have an advantage when ranking in search engines.

5 letter Aged Agriculture Alliterative Crafts Energetic Fitness Friendly Health Invented Luxury Masculine Media Modern News Transport Travel Video & film

expression and extracellular release of a functional anti-trypanosome nanobody in sodalis glossinidius , a bacterial symbiont of the tsetse fly | microbial cell factories | full text

expression and extracellular release of a functional anti-trypanosome nanobody in sodalis glossinidius , a bacterial symbiont of the tsetse fly | microbial cell factories | full text

Sodalis glossinidius, a gram-negative bacterial endosymbiont of the tsetse fly, has been proposed as a potential in vivo drug delivery vehicle to control trypanosome parasite development in the fly, an approach known as paratransgenesis. Despite this interest of S. glossinidius as a paratransgenic platform organism in tsetse flies, few potential effector molecules have been identified so far and to date none of these molecules have been successfully expressed in this bacterium.

In this study, S. glossinidius was transformed to express a single domain antibody, (Nanobody) Nb_An33, that efficiently targets conserved cryptic epitopes of the variant surface glycoprotein (VSG) of the parasite Trypanosoma brucei. Next, we analyzed the capability of two predicted secretion signals to direct the extracellular delivery of significant levels of active Nb_An33. We show that the pelB leader peptide was successful in directing the export of fully functional Nb_An33 to the periplasm of S. glossinidius resulting in significant levels of extracellular release. Finally, S. glossinidius expressing pelBNb_An33 exhibited no significant reduction in terms of fitness, determined by in vitro growth kinetics, compared to the wild-type strain.

These data are the first demonstration of the expression and extracellular release of functional trypanosome-interfering Nanobodies in S. glossinidius. Furthermore, Sodalis strains that efficiently released the effector protein were not affected in their growth, suggesting that they may be competitive with endogenous microbiota in the midgut environment of the tsetse fly. Collectively, these data reinforce the notion for the potential of S. glossinidius to be developed into a paratransgenic platform organism.

Tsetse flies (Glossina sp.) are medically important, viviparous dipterans that transmit Trypanosoma spp. parasites responsible for human sleeping sickness and Animal African trypanosomiasis. This biological transmission is based on a complex developmental cycle that these protozoan parasites have to go through in the tsetse fly alimentary tract and mouthparts (Trypanosoma congolense) or salivary glands (T. brucei sp.). Similar to other blood feeding insects, tsetse flies rely on bacterial symbionts to acquire nutrients that are insufficiently present in their diet and which they are unable to synthesize themselves. Sodalis glossinidius is a maternally inherited gram-negative bacterial endosymbiont of the tsetse fly that can be found both inter- and intracellularly in the tsetse fly midgut, muscle, fat body, milk glands, and salivary glands [1]. Given the close proximity of S. glossinidius to the different insect tissues where trypanosome parasites reside and the fact that it is one of the few insect symbiotic bacteria that can be cultured and genetically modified in vitro[13], S. glossinidius is considered as a potential in vivo drug delivery vehicle to control T. congolense and T. brucei development in the fly. This strategy involving the use of bacterial symbionts to express foreign proteins, designed to block pathogen transmission, is often referred to as paratransgenesis [4] and has been developed and proposed to combat different insect-borne animal and human diseases [57]. The control of the trypanosome parasite in the tsetse fly using paratransgenic technology requires the identification and characterization of gene products that interfere with trypanosome development without reducing the fitness of the tsetse host or its symbiont.

To date, genes involved in insect immunity have attracted most attention as potential antitrypanocidal effectors. In Glossina morsitans morsitans, the host defense genes attacin and defensin are up-regulated in response to trypanosome infection [810] and antitrypanosomal activity has been shown for the recombinant attacin protein [11]. Another potential effector protein is an antimicrobial host defense protein produced by bovine neutrophils with trypanocidal activity, BMAP-27 [12]. Indeed, this bovine myeloid antimicrobial peptide has been shown to exhibit high toxicity towards two major life cycle stages of African trypanosomes (bloodstream-form and procyclic-form) However, to date none of these peptides have been successfully expressed in the tsetse fly bacterial symbiont S. glossinidius.

The identification of monoclonal antibodies (mAbs) that recognize parasite surface proteins, and their subsequent expression as single chain antibody gene fragments (ScFv), provides an alternative as potential antipathogenic effectors. The feasibility of expressing ScFvs in bacterial symbionts that retain their functional activities has been demonstrated in Rhodococcus[13] and Pantoea agglomerans[7]. However, due to their bulky size (30 kDa range) and complex architecture mAbs are often prone to aggregation and reduced affinity [14, 15].

Nanobodies (Nbs) represent the smallest known intact antigen-binding fragments derived from heavy-chain only antibodies (HCAbs), devoid of light chains, naturally occurring in Camelidae and sharks [1618] (reviewed by [19]). Due to their ability to target unique epitopes that are less well targeted by conventional antibodies, Nbs are currently of high research interest for various pharmaceutical applications, including diagnosis and drug delivery [20, 21]. Because of their superior intrinsic properties, e.g. small size (13-15 kDa), strict monomeric behavior and high in vitro stability [17, 22] Nbs are efficiently produced in micro-organisms such as Escherichia coli[23] and therefore show high potential as effector molecules in the paratransgenesis approach. Nbs directed towards distinct regions of the variant-specific surface glycoprotein (VSG), abundantly present on the surface of bloodstream trypanosomes, have already been identified, targeting VSG epitopes that are inaccessible on live trypanosomes for larger antibodies [24]. An essential aspect for a successful symbiont-based paratransgenesis approach is the active release of the effector molecules to the inner insect environment for efficient targeting of the pathogen. However, few studies have focused on the export of heterologous proteins to the periplasmatic and/or outer environment of S. glossinidius.

In this study, we aimed to investigate the potential of S. glossinidius to express functional Nbs without interfering with cell viability. Secondly, we evaluated the capability of two independent secretion signals, predicted to be involved in different protein secretion pathways, to deliver the effector proteins to the extracellular environment. We show that Nb_An33, recognizing a VSG epitope on Trypanosoma brucei[24] was expressed by S. glossinidius. Furthermore, we demonstrated that the pectate lyaseB (pelB) signal peptide from Erwinia carotovora is able to direct the export of fully functional Nb_An33 to the periplasm of S. glossinidius resulting in significant levels of extracellular release. Importantly, Sodalis strains that efficiently released the effector protein were not affected in their growth, suggesting that they may be competitive with endogenous microbiota in the midgut environment of the tsetse fly.

We examined the capability of Sodalis glossinidius to express/export Nb_An33 through the use of expression plasmids harboring the coding sequence for Nb_An33 fused to two independent secretion signals, one of which is native to S. glossinidius. A schematic presentation of the structure of the fused genes is shown in Figure 1. For the first secretion construct, Nb_An33 was fused to the pelB leader sequence. As S. glossinidius is devoid of a lac repressor, the presence of the lac promoter resulted in a constitutive expression of pelBNb_An33. The second secretion signal was that for the flagellin protein FliC of S. glossinidius, one of the most abundant proteins on the bacterial surface and the major component of the flagellum [25]. Here, the construct contained the promoter and the 5'untranslated region (UTRs) of the S. glossinidius FliC gene which according to Majander et. al. [26] facilitates the extracellular secretion of polypeptides via the type III pathway in E. coli. The expression of the different Nb_An33 constructs was examined in both E. coli and S. glossinidius. The pelB leader resulted in the extracellular release of Nb_An33 from S. glossinidius and E. coli as shown by Western blot analysis (Figure 2). Here, the Nb_An33 is present as a 13.8 kDa protein both in the periplasmic fraction and cell-free culture supernatant of both bacterial species. As this size is identical with the Nb_An33 that was expressed without any secretion signal, it confirms the correct cleavage of the pelB leader peptide during periplasmatic transport. Moreover, the Nb_An33 devoid of the secretion signal accumulated exclusively in the cytoplasm. The FliC-Nb_An33 fusion protein was expressed in the cytoplasm of S. glossinidius and E. coli, however in neither species was the fusion protein exported to the periplasm nor extracellular medium. Figure 2 shows that the fusion protein remained within the cells as a 22.5 kDa protein, corresponding with the molecular weight of the fusion construct. Finally, an expression plasmid was constructed containing both pelB and FliC secretion signals fused to Nb_An33 and under the control of the FliC promotor, i.e. pFliCpelBNb33fliC. Here, Nb_An33 could be detected as a 13.8 kDa protein both in the periplasm and extracellular medium of E. coli and S. glossinidius. Interestingly, immunoblotting of cytoplasmic fractions shows that two forms of the FliCpelB-Nb_An33 fusion protein could be detected: Nb_An33 (13.8 kDa) and Nb_An33 coupled to both pelB and FliC secretion signals (24,5 kDa). The expression and localization of the Nb_An33 for the different expression constructs are summarized in Table 1.

Schematic presentation of the gene constructs used in this study. Lines represent untranslated DNA regions, filled bars the coding region of Nb_An33 and open bars the coding regions of the respective secretion signals. All gene constructs contain a 6xhis tag (6H) at the carboxy terminal end for purification purposes. Plac and PFliC indicate the lac promoter and the promoter region of the S. glossinidius fliC gene respectively. 5'-UTR indicates the 5' untranslated sequence of fliC including the fliC promotor. FliC1-70 refers to the size in amino acids of the fragment of the S. glossinidius FliC protein containing the predicted signal sequence.

Qualitative analysis of intracellular (cytoplasmic and periplasmic) and extracellular Nb_An33 fusion proteins expressed from E. coli (left panel) and S. glossinidius (right panel) harboring the different expression plasmids. E. coli and S. glossinidius samples were not normalized for cell density as these two host cells reach different cell densities at early stationary phase. The localization of the expressed Nb-An33 fusions were analyzed by immunoblotting of cytoplasmic (C) and periplasmic (P) fractions and medium supernatant (S) using an anti-His antibody (1:1000 Serotec) for detection. Presented data are representative for at least three independent experiments. Molecular size markers in kDa are indicated on the gels.

In order to determine the overall effect of the Nb expression and extracellular release on the bacterial fitness, we examined the growth rates of S. glossinidius strains harboring the various expression constructs and compared them to the WT strain (Figure 3). Under standard microaerophilic conditions S. glossinidius divides very slowly, however they can be grown under oxidative stress once cultures have reached a cell density sufficient to ensure activation of the oxidative-stress response regulated via a quorum-sensing mechanism (OD600: 0.03; [27]). Therefore, cultures were grown without shaking for the first 48 h and then transferred to a shaking incubator. The growth curves of the S. glossinidius strains periplasmatically expressing Nb_An33 (S. glossinidius:ppelBNb33lac and S. glossinidius:pFliCpelBNb33fliC) were indistinguishable from the WT strain. However, S. glossinidius strains expressing Nb_An33 cytoplasmatically (S. glossinidius:pNb33lac and S. glossinidius:pFliCNb33fliC) showed a lower maximum density as compared to the WT strain (Figure 3). These results are consistent with the calculated cell population doubling time of the different strains during the exponential growing phase of the culture. The doubling times (in hours) for the Nb_An33 exporting strains are identical with that of the WT strain whereas the Nb non-exporting Sodalis strains demonstrated an elevated doubling time: WT, 7.75 h 0.07; pNb33lac, 8.74 h 0.1; ppelBNb33lac, 7.87 h 0.04; pFliCNb33fliC, 8.92 h 0.15; pFliCpelBNb33fliC, 7.80 h 0.14. These data indicate that intracellular expression of Nb_An33 has an inhibitory effect on growth compared to the WT strain, while secreting strains are not affected in their growth.

Growth curve analysis of S. glossinidius expressing and/or secreting recombinant Nb_An33. The error bars show the SD of two biological replicates. Samples were taken every 24 h except during exponential growth (day 3 and 4), 2 samples/24 h were taken (a and b).

Nb_An33 expression and release was quantified by measuring the concentration of active Nb_An33 in the whole cell fraction and supernatant using enzyme-linked immunosorbent assay (ELISA). Extracellular and intracellular concentrations of Nb_An33 produced by S. glossinidius harboring the pelBNb33lac and FliCpelBNb33fliC plasmids were analyzed at different time points during bacterial growth over a 8-day period and results are shown in Figure 4. During logarithmic growth (day 3) of the pelBNb33lac harboring strain, a release efficiency of 20% was estimated, calculated as the percentage of the Nb present in the culture medium on the total amount of expressed Nb. The release efficiency increased to 25% during stationary phase, i.e. day 4. During this stage of the growth curve (day 1- day 4) no significant cell death occurred as measured by the Live/Dead BacLight bacterial viability test (data not shown). After the cells reached saturation, a drastic increase of active extracellular Nb_An33 was measured from 60% of total protein at day 5 to 80% at day 8. Here, active Nb_An33 accumulated in the culture medium of S. glossinidius expressing pelBNb33 at concentrations of 160 ng/ml. The release efficiency of S. glossinidius harboring the FliCpelBNb33fliC plasmid showed a similar pattern as the pelBNb33lac harboring strain with an efficiency of 35% and 81% at day 4 and 8 respectively. However, the amount of active intra- and extracellular Nb_An33 produced by S. glossinidius expressing FliCpelBNb33 was lower compared to the pelBNb33 expressing strain. Given that these concentrations were determined by a VSG-binding ELISA these results indicate that the Nb_An33 expressed by recombinant S. glossinidius is functional in terms of antigen-binding.

ELISA based Nb_An33 quantitation using a 6 His tag specific detection antibody in order to determine the intra- and extracellular nanobody concentration produced by S. glossinidius harboring pelBNb33 lac and FliCpelBNb33 fliC plasmids at selected time points. Samples were taken every 24 h except during exponential growth (day 3 and 4), 2 samples/24 h were taken (a and b). Values are presented as ng recombinant protein per ml culture medium. The error bars show the SD of two biological replicates. Presented data are representative for two independent experiments.

The functionality of the extracellularly released Nb_An33 was further evaluated by analyzing its binding ability to living trypanosomes via flow cytometry and microscopy. Sodalis cells periplasmatically expressing Nb_An33 was grown in a 1.5 L liquid culture to an OD600 0.5. Nb_An33 was purified from the periplasm by immobilized metal affinity chromatography and gel filtration (Figure 5). The eluted fractions were pooled and concentrated on Vivaspin concentrators. Comparison of the size exclusion chromatograms of Nb_An33 produced by Sodalis versus E. coli reveals identical retention times. The purity of the concentrated eluded fractions was confirmed via immuno- and Coomassie staining (Figure 5, inset). Flow cytometry analysis showed that purified trypanosomes expressing AnTat1.1 VSG were stained upon the addition of Alexa488-labelled Nb_An33 (Figure 6A, green histogram). In the same experimental set-up, parasites were incubated with a control Alexa488-labelled Nb with no VSG specificity and the profile is indistinguishable from an unstained sample of parasites (Figure 6A, dashed and red histogram). Analysis of the samples by immunofluorescence microscopy showed a staining of the living parasites over their entire surface when incubated with Alexa488-labeled Nb_An33 at 4C. However, during the microscopical analysis at room temperature (RT) the fluorescent labeled Nb accumulated mainly in the trypanosome flagellar pocket (FP) (Figure 6B). Together, these results provide definite evidence that Nb_An33 released by S. glossinidius is fully functional and able to target its specific epitope that is present in the dense VSG coat of living parasites.

Size-exclusion chromatography profile (solid line) of the Ni-NTA eluted periplasmic extract from S. glossinidius expressing FlicpelBNb33 loaded onto a Superdex-75 (10/30) column using PBS as running buffer. Affinity purified S. glossinidius Nb_An33 eluted at the positions indicated by the arrow. The dotted line represents the elution pattern of Nb_An33 purified from E. coli. Eluted fractions containing S. glossinidius Nb_An33 were pooled and purity was evaluated by SDS-PAGE gel electrophoresis and anti-His Western blot (inset).

Recognition of living trypanosomes expressing AnTat1.1 by ALEXA488-labelled Nb_An33 purified from S. glossinidius. A) Flow cytometry profile Red histogram: profile of parasites in the absence of Nbs. A non VSG specific Alexa488-labelled control nanobody did not significantly bind to the trypanosome surface (Blue dashed histogram). Green histogram: profile of parasites bound by Alexa 488-labelled Nb_An33 secreted by Sodalis glossinidius. B) Immuno-fluorescence microscopy. When maintained at room temperature surface bound Alexa488-labelled Nb_An33 gradually accumulated in the parasite flagellar pocket (FP).

Genetically modified bacterial symbionts of arthropod disease vectors are potential tools for the delivery of proteins that interfere with pathogen development in the vector and may serve as a powerful complementary approach to control disease transmission [2]. Furthermore, the use of bacterial symbionts expressing foreign proteins in disease-carrying arthropods has also an intriguing potential for studying insect-pathogen interactions. The advent of Nanobody technology has offered new prospects for the development of new effector molecules applicable for the paratransgenesis approach. These single-domain antigen-binding fragments represent exquisite targeting tools because of their small size (13-15 kDa) and stability properties [17, 22]. Despite the interest for a paratransgenesis approach in tsetse flies to control transmission of African trypanosomiasis, little progress has been made on the identification and expression of trypanosome-interfering proteins in the tsetse fly bacterial endosymbiont Sodalis glossinidius. To date, S. glossinidius strains have only been used as hosts for the production of GFP [1]. In this study we explored the possibility of expressing a trypanosome-interfering Nanobody in Sodalis glossinidius. We have developed a suitable expression vector that allows for the expression in S. glossinidius of an anti-trypanosome Nanobody, Nb_An33 that targets a high-mannose carbohydrate epitope present on the Variant-specific Surface Glycoprotein of Trypanosoma brucei[24].

Importantly, to control parasites in the tsetse fly, it is imperative for the effector molecules to reach their target. In an effort to address the need for an efficient secretion system we evaluated two distinct bacterial secretion pathways in their capacity to deliver Nbs to the extracellular environment. Nb_An33 fused to the S. glossinidius FliC secretion signal was expressed by both S. glossinidius and E. coli. However, in neither species could the fusion protein be detected in the culture medium nor the periplasm. The underlying reasons for this secretion failure remains unclear. One possibility includes the presence of a functional Sodalis glossinidius flagellar cap protein FliD, responsible for the polymerization of the FliC monomers into a filament, which would hinder the release of the FliC-fusion protein into the extracellular medium [26].

Nb_An33 was successfully exported to the S. glossinidius and E. coli periplasm using the pelB signal peptide. Furthermore, in both species the recombinant protein accumulated in the culture medium with an extracellular export efficiency in Sodalis of 20-25% during exponential and stationary growth phase where cell lysis is negligible. The extracellular release of small proteins and antibody fragments that were secreted into the periplasm via the pelB signal peptide has already been described [7, 28]. The occurrence of this phenomenon appears to be highly dependent on the characteristics of the protein and is not yet fully understood. The secretion of some recombinant proteins to the periplasm is suggested to cause a destabilization of the outer membrane, which becomes leaky and results in the non-specific release of periplasmic proteins to the extracellular environment [29, 30]. The pelB signal peptide is known to direct protein translocation to the periplasm via the Sec-dependent type II secretion pathway [31]. The feasibility of this pathway to export heterologous proteins to the periplasm of S. glossinidius complements the twin-arginine translocation (Tat) pathway, also involved with periplasmic transport, which was previously demonstrated to be functional in Sodalis glossinidius[32].

Additionally, the ELISA results indicated that during the stationary and cell lysis phase of the growth curve, S. glossinidius cells harboring the ppelBNb33lac plasmid released functional Nb_An33 in the culture medium where it accumulated at concentrations as high as 160 ng/ml. This clearly indicates that the release of Nbs from lysing Sodalis cells to the extracellular environment could also be an important way for the expressed Nb to reach its trypanosome target in the lumen of the tsetse fly. For both S. glossinidius strains harboring pNb33lac and pFliCNb33fliC, the amount active Nb_An33 expression was below the detection limit in ELISA, probably due to the fact that biological activity is dependent on correct protein folding involving the formation of disulfide bonds which is unlikely to occur in the reducing environment of the cytoplasm. The ELISA results also demonstrated that the secreted Nb_An33 was perfectly functional in terms of antigen binding to purified soluble AnTat 1.1 VSG in vitro.

Another important consideration when expressing potential effector proteins into the midguts of blood feeding arthropods is the susceptibility of the effectors to proteolytic degradation. Spiking of midgut extracts from tsetse flies with purified Nb_An33 in an ELISA assay demonstrated that Nb_An33 retains its antigen binding properties (unpublished results), providing preliminary evidence that Nb_An33 remains functional within the midgut environment of the fly. Furthermore, Nbs can easily be mutagenized and selected for increased proteolytic stability [33].

Finally, the capacity of the secreted Nb_An33 to recognize its epitope on living trypanosomes was confirmed by flow cytometry and fluorescence microscopy using alkaline binding conditions that are relevant for the tsetse fly midgut physiology.

Growth curve analysis and cell population doubling time of the S. glossinidius strains harboring the different expression constructs showed that there was a strong correlation between the ability of the S. glossinidius strains to export the Nb_An33 fusion protein and growth performance. Strains expressing Nb_An33 intracellularly showed a significant reduction in growth rate compared to the WT strains, while secreting strains were not affected in their growth. These results suggest that accumulation of Nb_An33 in the cytoplasm imparts a detrimental effect on growth performance and that efficiently secreting Nb_An33 to the periplasm rescues this effect, allowing the strain to grow with kinetics similar to the WT strain.

This study provides the first demonstration of the functional expression and extracellular delivery of trypanosome-interfering proteins in S. glossinidius. Moreover, we demonstrated that S. glossinidius expressing pelBNb_An33 exhibited no significant reduction in terms of fitness, determined by in vitro growth kinetics, compared to the wild-type strain. This ability of the recombinant S. glossinidius strain to effectively compete with native strains is of great importance to the overall success of the paratransgenesis strategy. Given the ability of S. glossinidius to express high levels of active Nb_An33 and the capacity to release this anti-trypanosome Nb without hampering the bacterium viability, the foundation has been laid for further exploration of the inhibitory effect on trypanosome development in the tsetse fly. For this, highly potent trypanolytic Nbs have been developed very recently that lyse trypanosomes both in vitro and in vivo by interfering with the parasite endocytic pathway [34].

The current study also reinforces the notion for the potential of S. glossinidius to be developed into a paratransgenic platform organism. At a broad level, the concept of using Nbs as effector molecules to be delivered by bacterial endosymbionts is not limited to the tsetse fly-trypanosome model but could also be applied in a paratransgenic approach to encompass other vector-borne diseases.

Sodalis glossinidius strains used in this study were isolated from the hemolymph of surface-sterilized Glossina morsitans morsitans from the colony maintained at the Institute of Tropical Medicine (Antwerp, Belgium). Cultures were maintained in vitro at 26C in liquid Mitsuhashi-Maramorosch (MM) insect medium (PromoCell) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS). For cloning, S. glossinidius strains were cultivated on MM agar plates composed of MM medium (without FBS) solidified by autoclaving after the addition of 1% of bacto-agar. Blood agar plates were supplemented with 10% packed horse blood cells (IMP) and yeastolate (5 mg/ml) (Gibco). All solid cultures were cultivated in micro-aerophilic conditions generated using the Campygen pack system (Oxoid) which provided 5% O2, 10% CO2, balanced with N2 at 26C. Where appropriate, antibiotics were added to the media at the following concentrations: 100 g/ml of ampicillin and 50 g/ml of kanamycin.

Plasmids used in this study and the structure of the fused genes are shown in Figure 1. Nb_An33, coupled to the pelB leader sequence and followed by a 6xHis tag was amplified as a XbaI-EcoRI fragment by PCR from the pHen6C plasmid containing the pelBNb33 gene using the following primer set: pelBNb33_FW, 5'-TTTTTCTAGAATGAAATACCTATTGCCTACGG-3' and Nb33_Rev, 5'- TTTTGAATTCTTAGTGATGGTGATGGTGGTGTGAGGAGACGGTGACCTG-3' (XbaI-EcoRI restriction sites are underlined). The resulting 438 bp PCR product was cloned into pCM66 [35] to create ppelBNb33lac. Nb33_FW, 5'-ATATTCTAGATGATGTGCAGCTGGTGGAGTC-3' was used to create pNb33lac without any secretion signal. To create pFliCNb33fliC and pFliCpelBNb33fliC, a 510 bp fragment including the FliC promoter region (PfliC) and a 210 bp fragment FliC, encoding 70 N-terminal amino acids of the S. glossinidius FliC gene, was inserted in-frame between the SphI-XbaI restriction sites of pNb33lac and ppelBNb33 respectively, with the following primer set: FliC_FW, 5'- GCATGCCATGTCCCAGGTCATT-3' and FliC_Rev, 5'-ATATCTAGAGTCATTGGCGCATG-3'(SphI-XbaI restriction sites are underlined). All plasmids were sequenced to confirm the desired DNA sequence and the correct reading frame.

Plasmid constructs were transformed in wildtype (WT) S. glossinidius cells using a heat-shock method [2]. Transformed cells were allowed to recover overnight at 26C prior to plating onto MM-blood agar, supplemented with kanamycin and a single recombinant S. glossinidius colony was inoculated into liquid culture.

Cultures were grown to the beginning of stationary phase (S. glossinidius OD600 0.5-0.6; E. coli OD600 1,5-2). Cells were pelleted from bacterial cultures by centrifugation (15 min, 10000 g) and the supernatant was clarified from residual bacterial cells by a second centrifugation step. Proteins in the growth medium were precipitated with 10% trichloroacetic acid (TCA) for 1 h on ice. From the pelleted cells, periplasmic proteins were extracted by osmotic shock [36]. For SDS-PAGE, samples were heat denatured at 95C in the presence of SDS-PAGE loading buffer containing -mercaptoethanol and analyzed on a 12% (w/v) polyacrylamide gel. Proteins were transferred onto a nitrocellulose membrane (Whattman). After overnight blocking with 1% (w/v) bovine serum albumin, the membrane was incubated sequentially with a mouse anti-6xHis-tag IgG1 antibody (1:1000) (Serotec) and a rabbit anti-mouse-IgG antibody (1:1000) (Serotec) conjugated to horseradish peroxidase. In between these successive 2 h incubations, the membrane was washed with PBS-0.1% Tween 20. Thirty minutes after adding the substrate (TMB 1-Component Membrane Peroxidase Substrate, KPL) the reaction was stopped by washing the membrane with water.

Logarithmically growing cultures were used to inoculate 25 ml of MM-medium to an optical density at 600 nm (OD600) of 0.005. Cultures of the different S. glossinidius strains were allowed to grow without shaking for 48 h and samples were taken every 24 h. Then cultures were transferred to a shaking incubator and grown in alternating cycles (12 h) of static and shaking conditions. During the exponential growth rate 2 samples/day were taken. Doubling times during exponential growing phase were calculated using the following equation: doubling time (in hours) = h*ln(2)/ln(c2/c1) where c1 is the initial concentration and c2 is the concentration when cultures reached maximum densities.

The amount of active Nb_An33 present in cytoplasmic extracts and growth medium was quantified using an optimized Nanobody Solid-phase Binding enzyme-linked immunosorbent assay (ELISA) [37]. Samples were taken at the same time points indicated for the growth curve measurements. At each time point, 1 ml of culture media was centrifuged two times (8000 g) to obtain the extracellular and whole cell fractions. The whole cell extracts were prepared by resuspending the cell pellets in 0.2 ml PBS supplemented with protease inhibitor (Roche) followed by sonication at an amplitude of 10 m for 5 s (3 cycles on ice).

Maxisorb 96-well plates (Nunc) were coated overnight (4C) with 200 ng purified soluble AnTat 1.1 VSG (target of Nb_An33) per well in 0.1 M NaHCO3, pH 8.2. Residual protein binding sites were blocked for two hours at room temperature with 0.5% bovine serum albumin (BSA) in PBS. In order to quantify Nb_An33 present in cytoplasmic extracts and growth medium, a standard serial dilution series (1:2) starting from 2500 to 5 ng/ml of purified Nb_An33 was prepared in PBS and MM-medium respectively. MM medium and PBS alone were included as blanks. Standards, cytoplasmic and extracellular fractions were added for 1 h at room temperature. Detection of antigen-bound Nanobodies was performed with a mouse anti-6xHis IgG antibody (Serotec) directly conjugated to horseradish peroxidase. Thirty minutes after adding peroxidase substrate, the reaction was stopped with 0.33 M H2SO4 and the optical density was measured at 450 nm (690 nm was used as reference filter). Protein concentrations were calculated from a standard curve fitted to a four parameter logistic equation using the Ascent software (Labsystems).

Purification of Trypanosoma b. brucei AnTat1.1 soluble VSG was prepared as described earlier [23]. Trypanosoma b. brucei AnTat1.1 bloodstream parasites were grown in mice and purified from their heparinized blood by using diethylaminoethyl cellulose (DEAE) anion exchange chromatography on mAECT columns [38]. Mouse care and experimental procedures were performed under approval from the Animal Ethical Committee of the Vrije Universiteit Brussel, (VUB), Belgium (ethical clearance N 09-220-08).

Large-scale production of Sodalis Nb_An33 was performed in 500 ml shake flasks by growing the bacteria in an orbital shaker at 200 rpm to an OD600 nm of approximately 0.5. After cells were pelleted, periplasmic proteins were extracted by osmotic shock [36] and medium was concentrated and extensively dialyzed (6-8 kDa MWCO Spectra/Por dialysis membrane, Spectrum laboratories) against PBS. Proteins were purified from the periplasmic fraction and medium using affinity chromatography on a Ni-NTA Superflow column (Qiagen). The eluted fractions were concentrated on Hydrosart Vivaspin concentrators with a molecular mass cutoff of 5 kDa (Vivascience). Further purification was performed by size-exclusion chromatography (AKTA explorer, GE Healthcare) using a Superdex75 (HR10/30) column equilibrated with PBS and the purity of the proteins was evaluated by Coomassie-stained 12% SDS-polyacrylamide gel and their identity confirmed by 6 His tag specific immunodection in Western blot. ALEXA Fluor 488 labelling of the nanobody was accomplished using the Alexa Fluor 488 Monoclonal Antibody Labeling Kit (Molecular Probes) according to the manufacturer's instructions. To separate the nanobody from free label, a second Superdex 75 (HR10/30) gel filtration chromatography was performed.

The binding capabilities of the labeled and purified Nb_An33 from S. glossinidius was evaluated on live, bloodstream form AnTat1.1 trypanosomes through flow cytometry. Aliquots of purified parasites (2 105 in 20 l HMI-9 medium + 15% FCS, pH 8, [39]) were cooled on ice prior to adding ALEXA-labeled Nb_An33. After 30 min of incubation parasites were washed (8 min, 850 g) with HMI9 medium to remove free label and analyzed in by flow cytometry on a FACS Canto II and histograms were prepared using the FlowJo software (Becton Dickinson, San Jose, CA). Immunofluorescence microscopy was performed on the same samples using a Nikon ECLIPSE E600 epifluorescence microscope equipped with a Plan Apo 60 oil-immersion objective lens.

Beard CB, O'Neill SL, Mason P, Mandelco L, Woese CR, Tesh RB, et al: Genetic transformation and phylogeny of bacterial symbionts from tsetse. Insect Mol Biol. 1993, 1: 123-131. 10.1111/j.1365-2583.1993.tb00113.x.

Aksoy S, Weiss BL, Attardo G: Transgenesis and the management of vector-borne diseases. Paratransgenesis applied for control of tsetse transmitted sleeping sickness. Edited by: Aksoy S. 2008, Landes Bioscience: Texas, 35-45.

Durvasula RV, Gumbs A, Panackal A, Kruglov O, Aksoy S, Merrifield RB, et al: Prevention of insect-borne disease: an approach using transgenic symbiotic bacteria. Proc Natl Acad Sci USA. 1997, 94: 3274-3278. 10.1073/pnas.94.7.3274.

Bisi DC, Lampe DJ: Secretion of anti-Plasmodium effector proteins from a natural Pantoea agglomerans isolate by using PelB and HlyA secretion signals. Appl Environ Microbiol. 2011, 77: 4669-4675. 10.1128/AEM.00514-11.

Hao Z, Kasumba I, Lehane MJ, Gibson WC, Kwon J, Aksoy S: Tsetse immune responses and trypanosome transmission: implications for the development of tsetse-based strategies to reduce trypanosomiasis. Proc Natl Acad Sci USA. 2001, 98: 12648-12653. 10.1073/pnas.221363798.

Boulanger N, Brun R, Ehret-Sabatier L, Kunz C, Bulet P: Immunopeptides in the defense reactions of Glossina morsitans to bacterial and Trypanosoma brucei brucei infections. Insect Biochem Mol Biol. 2002, 32: 369-375. 10.1016/S0965-1748(02)00029-2.

Haines LR, Hancock RE, Pearson TW: Cationic antimicrobial peptide killing of African trypanosomes and Sodalis glossinidius, a bacterial symbiont of the insect vector of sleeping sickness. Vector Borne Zoonotic Dis. 2003, 3: 175-186. 10.1089/ 2662165.

Durvasula RV, Gumbs A, Panackal A, Kruglov O, Taneja J, Kang AS, et al: Expression of a functional antibody fragment in the gut of Rhodnius prolixus via transgenic bacterial symbiont Rhodococcus rhodnii. Med Vet Entomol. 1999, 13: 115-119. 10.1046/j.1365-2915.1999.00175.x.

Whitlow M, Bell BA, Feng SL, Filpula D, Hardman KD, Hubert SL, et al: An improved linker for single-chain Fv with reduced aggregation and enhanced proteolytic stability. Protein Eng. 1993, 6: 989-995. 10.1093/protein/6.8.989.

Flajnik MF, Deschacht N, Muyldermans S: A case of convergence: why did a simple alternative to canonical antibodies arise in sharks and camels?. PLoS Biol. 2011, 9: e1001120-10.1371/journal.pbio.1001120.

Cortez-Retamozo V, Backmann N, Senter PD, Wernery U, De BP, Muyldermans S, et al: Efficient cancer therapy with a nanobody-based conjugate. Cancer Res. 2004, 64: 2853-2857. 10.1158/0008-5472.CAN-03-3935.

Saerens D, Stijlemans B, Baral TN, Nguyen Thi GT, Wernery U, Magez S, et al: Parallel selection of multiple anti-infectome Nanobodies without access to purified antigens. J Immunol Methods. 2008, 329: 138-150. 10.1016/j.jim.2007.10.005.

Arbabi GM, Desmyter A, Wyns L, Hamers R, Muyldermans S: Selection and identification of single domain antibody fragments from camel heavy-chain antibodies. FEBS Lett. 1997, 414: 521-526. 10.1016/S0014-5793(97)01062-4.

Stijlemans B, Conrath K, Cortez-Retamozo V, Van XH, Wyns L, Senter P, et al: Efficient targeting of conserved cryptic epitopes of infectious agents by single domain antibodies. African trypanosomes as paradigm. J Biol Chem. 2004, 279: 1256-1261.

Majander K, Anton L, Antikainen J, Lang H, Brummer M, Korhonen TK, et al: Extracellular secretion of polypeptides using a modified Escherichia coli flagellar secretion apparatus. Nat Biotechnol. 2005, 23: 475-481. 10.1038/nbt1077.

Pontes MH, Babst M, Lochhead R, Oakeson K, Smith K, Dale C: Quorum sensing primes the oxidative stress response in the insect endosymbiont Sodalis glossinidius. PLoS One. 2008, 3: 3541-10.1371/journal.pone.0003541.

Jonasson P, Liljeqvist S, Nygren PA, Stahl S: Genetic design for facilitated production and recovery of recombinant proteins in Escherichia coli. Biotechnol Appl Biochem. 2002, 35: 91-105. 10.1042/BA20010099.

De Vooght L, Caljon G, Coosemans M, Van den Abbeele J: Functional analysis of the twin-arginine translocation pathway in Sodalis glossinidius, a bacterial symbiont of the tsetse fly. Appl Environ Microbiol. 2011, 77: 1132-1134. 10.1128/AEM.02379-10.

Harmsen MM, Van Solt CB, Van Zijderveld-Van Bemmel AM, Niewold TA, Van Zijderveld FG: Selection and optimization of proteolytically stable llama single-domain antibody fragments for oral immunotherapy. Appl Microbiol Biotechnol. 2006, 72: 544-551. 10.1007/s00253-005-0300-7.

Stijlemans B, Caljon G, Natesan SK, Saerens D, Conrath K, Perez-Morga D, et al: High affinity nanobodies against the Trypanosome brucei VSG are potent trypanolytic agents that block endocytosis. PLoS Pathog. 2011, 7: e1002072-10.1371/journal.ppat.1002072.

Caljon G, Caveliers V, Lahoutte T, Stijlemans B, Ghassabeh GH, Van Den Abbeele J, et al: Analysis of blood-brain barrier permeability of monovalent Nanobodies using microdialysis. Br J Pharmacol. 2012, doi: 10.1111/j.1476-5381.2011.01723.x

Buscher P, Mumba ND, Kabore J, Lejon V, Robays J, Jamonneau V, et al: Improved Models of Mini Anion Exchange Centrifugation Technique (mAECT) and Modified Single Centrifugation (MSC) for sleeping sickness diagnosis and staging. PLoS Negl Trop Dis. 2009, 3: e471-10.1371/journal.pntd.0000471.

Van RN, Pyana PP, Deborggraeve S, Buscher P, Claes F: Trypanosoma brucei gambiense: HMI-9 medium containing methylcellulose and human serum supports the continuous axenic in vitro propagation of the bloodstream form. Exp Parasitol. 2011, 128: 285-290. 10.1016/j.exppara.2011.02.018.

We are grateful to Dr. Marx, C.J. for providing the pCM66 plasmid. This research was supported by the Belgian Co-operation (Directorate-General for Development Co-operation, DGD), ITM SOFI-B grant, the InterUniversity Attraction Pole programme (IAP) and the ERC-Starting Grant 'NANOSYM'. This work is also performed in the frame of a FAO/IAEA Coordinated Research Project on "Improving SIT for tsetse flies through research on their symbionts and pathogens".

Conceived and designed the experiments: LDV, GC, JVDA. Performed the experiments: LDV, GC. Contributed reagents/materials/analysis tools: BS, PDB, MC, JVDA. Wrote the paper: LDV, GC, JVDA, BS, PDB, MC. All authors read and approved the final manuscript.

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

De Vooght, L., Caljon, G., Stijlemans, B. et al. Expression and extracellular release of a functional anti-trypanosome Nanobody in Sodalis glossinidius, a bacterial symbiont of the tsetse fly. Microb Cell Fact 11, 23 (2012). https://doi.org/10.1186/1475-2859-11-23

By using this website, you agree to our Terms and Conditions, California Privacy Statement, Privacy statement and Cookies policy. Manage cookies/Do not sell my data we use in the preference centre.

efficient 2,3-butanediol production from whey powder using metabolically engineered klebsiella oxytoca | microbial cell factories | full text

efficient 2,3-butanediol production from whey powder using metabolically engineered klebsiella oxytoca | microbial cell factories | full text

Whey is a major pollutant generated by the dairy industry. To decrease environmental pollution caused by the industrial release of whey, new prospects for its utilization need to be urgently explored. Here, we investigated the possibility of using whey powder to produce 2,3-butanediol (BDO), an important platform chemical.

Klebsiella oxytoca strain PDL-0 was selected because of its ability to efficiently produce BDO from lactose, the major fermentable sugar in whey. After deleting genes pox, pta, frdA, ldhD, and pflB responding for the production of by-products acetate, succinate, lactate, and formate, a recombinant strain K. oxytoca PDL-K5 was constructed. Fed-batch fermentation using K. oxytoca PDL-K5 produced 74.9g/L BDO with a productivity of 2.27g/L/h and a yield of 0.43g/g from lactose. In addition, when whey powder was used as the substrate, 65.5g/L BDO was produced within 24h with a productivity of 2.73g/L/h and a yield of 0.44g/g.

This study demonstrated the efficiency of K. oxytoca PDL-0 for BDO production from whey. Due to its non-pathogenicity and efficient lactose utilization, K. oxytoca PDL-0 might also be used in the production of other important chemicals using whey as the substrate.

Whey, a liquid by-product generated during cheese production, contains most of the water-soluble components in milk [1, 2]. Despite annual production of 145 million tons worldwide, only a little over one-half of the whey produced is utilized [3]. Whey is regarded as a serious pollutant because of its high biochemical oxygen demand (BOD,30,00050,000mg/L) and chemical oxygen demand (COD,60,00080,000mg/L) [3]. Economic disposal of whey has become a worldwide problem for the dairy industry. Lactose, a utilizable disaccharide for many microbial strains, is the major contributor to BODand CODof whey [4, 5]. Using the lactose in whey as a substrate for industrial microbial fermentation may transform a potential pollutant into a value-added product and this prospect deserves an intensive study.

2,3-Butanediol (BDO) is an important platform chemical that can be applied in many industrial fields [6,7,8]. Derivatives of BDO are estimated to have a potential global market of around 32 million tons per year. One common method for BDO synthesis is performed under harsh conditions (160220C, 50bar) with a C4 hydrocarbon fraction of cracked gases as the substrate [9, 10]. However, due to shortage of fossil fuels and increasing global environmental concerns, green production of BDO through microbial fermentation is desirable [11,12,13,14,15,16]. Renewable resources such as rice waste biomass, sugarcane bagasse hydrolysate, and kenaf core biomass have been used in fermentative production of BDO [17,18,19].

Several BDO-producing microorganisms can use fermentable sugars, including glucose, xylose, fructose, and lactose as the sole carbon source for growth [20,21,22,23]. However, these strains exhibit unsatisfactory fermentative performance in BDO production when lactose is used as the carbon source. For example, Klebsiella oxytoca NRRL-B199 can use the mixture of glucose and galactose as substrate for growth and produce BDO as its main product. Nevertheless, BDO was present in a low concentration and the strain produced acetate as the major product in the fermentation broth with lactose [24, 25].

Production of BDO using whey as the substrate can enhance the economic feasibility of BDO fermentation and facilitate resource utilization of the pollutant whey. Therefore, it is critical to identify a suitable microbial strain with BDO production potential using lactose and whey. In this study, we cultured Klebsiella pneumonia ATCC 15380, Enterobacter cloacae SDM, Bacillus licheniformis DSM13, K. oxytoca PDL-0, and Escherichia coli BL21-pETRABC in fermentation broths with lactose as the carbon source. K. oxytoca PDL-0 exhibited the best performance in lactose utilization and BDO production. Next, byproduct-producing genes in K. oxytoca PDL-0, including pox, pta, frdA, ldhD, and pflB, were knocked out to improve the efficiency of BDO production from lactose. Finally, high production of BDO from whey powder was achieved through fed-batch fermentation using the recombinant strain (Fig.1).

Metabolic engineering strategies for efficient production of BDO from whey powder by K. oxytoca PDL-0. Solid lines represent one step reactions. Dashed lines represent multi-step reactions. Blue crosses indicated the blocked pathways in the metabolic engineered strain. The target product is shaded in red and the blocked byproducts are shaded in blue. G1P glucose-1-phosphate, G6P glucose-6-phosphate, LacY lactose permease, LacZ -galactosidase, GlK glucose kinase, PGM phosphoglucomutase, PoxB pyruvate oxidase, PTA phosphotransacetylase, ACK acetate kinase, FrdA catalytic subunit of fumarate reductase, LdhD lactate dehydrogenase, PflB pyruvate formate-lyase, BudB -acetolactate synthase, BudA -acetolactate decarboxylase, BudC acetoin reductase

To select a strain for efficient BDO production from whey, we first assessed strains that can utilize lactose and produce BDO. K. pneumonia, E. cloacae, B. licheniformis, and K. oxytoca can produce BDO from glucose [16]. E. coli BL21-pETRABC carrying the BDO pathway gene cluster from E. cloacae can also efficiently bio-transform glucose into BDO [26]. In the present study, we first compared the ability of K. pneumonia ATCC 15380, E. cloacae SDM, B. licheniformis DSM13, K. oxytoca PDL-0, and E. coli BL21-pETRABC to produce BDO from lactose; results are shown in Fig.2.

Selection for stains that can produce BDO from lactose. Biomass (a), consumption of lactose (b), concentration (c) and yield (d) of BDO using lactose as the carbon source by E. cloacae SDM, E. coli BL21-pETRABC, B. licheniformis DSM13, K. pneumonia ATCC 15380, and K. oxytoca PDL-0 were assayed. The experiments were conducted in a 300-mL flask containing 50mL of M9 minimal medium supplemented with 5g/L yeast extract and 40g/L lactose with shaking at 180rpm for 48h. The culture temperature for B. licheniformis DSM13 was 50C while for other strains were 37C. The data for K. oxytoca PDL-0 and K. pneumoniae ATCC 15380 were obtained at 18h and 36h, respectively. The data for E. cloacae SDM, B. licheniformis DSM13 and E. coli BL21-pETRABC were obtained at 48h. Error bars indicate the standard deviations from three independent cultures

All five strains were cultured in M9 medium supplemented with 5g/L yeast extract and ~40g/L lactose for 48h. B. licheniformis DSM13 is the only strain that cannot consume lactose. E. cloacae SDM and E. coli BL21-pETRABC could grow well and utilize ~30g/L lactose within 48h, but only accumulated about 2g/L BDO (Additional file 1: Fig. S1, Fig.2ac). K. pneumonia ATCC 15380 and K. oxytoca PDL-0 can completely consume ~40g/L lactose within 36h and 18h, and produce BDO from lactose with a yield of 0.21g/g and 0.30g/g lactose, respectively (Additional file 1: Fig. S1 and Fig.2d). Considering the fact that K. oxytoca PDL-0 belongs to Risk Group 1 [15] and produces BDO from lactose with a higher yield than other strains, this strain was selected for further study in successive experiments.

Klebsiella oxytoca PDL-0 produced BDO as its major fermentative product during lactose fermentation in a shaking flask culture. However, only 56% of theoretical yield (0.293 vs 0.526g/g) was observed (Fig.3). BDO is produced by a fermentative pathway known as the mixed acid-BDO pathway in K. oxytoca [7, 15]. Acetate (1.57g/L), succinate (1.14g/L), lactate (1.34g/L), and formate (0.27g/L) were also detected as by-products in the fermentation broth (Fig.3).

Effects of by-product pathway genes knockout when using lactose as the carbon source. Biomass (a), consumption of lactose (b), by-products (c), concentration (d) and yield (e) of BDO by K. oxytoca PDL-0 and its derivatives were assayed. The experiments were conducted in a 300-mL flask containing 50mL of M9 minimal medium supplemented with 5g/L yeast extract and 40g/L lactose with shaking at 180rpm for 24h. The culture temperature was 37C. Error bars indicate the standard deviations from three independent cultures

In K. oxytoca PDL-0, the formation of acetate, succinate, lactate, and formate is catalyzed by pox and pta, frdA, ldhD, and pflB, respectively [27]. To achieve higher BDO yield, these genes were successively deleted in strain K. oxytoca PDL-0 (Fig.1). Effects of these gene deletions on growth, lactose consumption, by-product accumulation, and BDO production were studied in M9 medium supplemented with 5g/L yeast extract and ~40g/L lactose. As shown in Fig.3a, b, deletion of these by-product pathways in K. oxytoca PDL-0 had no effect on lactose consumption but did slightly increase growth. Accumulation of by-products, including acetate (0.23g/L), succinate (0.70g/L), lactate (0.11g/L), and formate (0g/L), was markedly decreased due to deletion of pox, pta, frdA, ldhD, and pflB (Fig.3c). The final strain, K. oxytoca PDL-K5, exhibited high concentration (16.0g/L) and yield (0.36g/g lactose) of BDO (Fig.3d, e) and low by-product generation (Fig.3c).

The effects of inactivation of by-product pathways on BDO production were further studied through batch fermentation in a 1-L fermenter. The strains K. oxytoca PDL-0 and K. oxytoca PDL-K5 were cultured in a fermentation medium containing corn steep liquor powder as a nitrogen source and ~40g/L lactose as carbon source. As shown in Fig.4a, b, K. oxytoca PDL-0 consumed 42.75g/L lactose and produced 15.26g/L BDO with a yield of 0.36g/g at 12h, while K. oxytoca PDL-K5 consumed 39.29g/L lactose and produced 17.65g/L BDO with a yield of 0.45g/g. Thus, the recombinant strain K. oxytoca PDL-K5 demonstrates advantages over wild type in both concentration and yield of BDO.

Batch fermentation using lactose as carbon source. Biomass, consumption of lactose, concentration of BDO and acetoin (AC) by K. oxytoca PDL-0 (a) and K. oxytoca PDL-K5 (b) were assayed. The experiments were conducted in a 1-L fermenter containing 800mL of medium with an initial lactose concentration of 40g/L approximately

To achieve higher product concentration, we performed fed-batch fermentation using strain K. oxytoca PDL-K5 with initial lactose concentration of ~100g/L. Fermentation medium containing corn steep liquor was used in a 7.5-L fermenter. As shown in Fig.5a, 173.2g/L lactose was consumed and 74.9g/L BDO was produced within 33h. The productivity was 2.27g/L/h and the yield was 0.43g/g lactose. The final concentration of the major by-product succinate was 0.82g/L and there was no formate production throughout the fermentation process (Additional file 1: Fig. S2a).

Fed-batch fermentation using lactose (a) and whey powder (b) as the carbon source. Biomass, consumption of lactose, concentration of BDO and acetoin (AC) by K. oxytoca PDL-K5 were assayed. The experiments were conducted in a 7.5-L fermenter containing 5L of medium with an initial lactose concentration of 100g/L approximately

Fed-batch fermentation using K. oxytoca PDL-K5 with whey powder as the carbon source was also conducted. After 24h of fermentation, 65.5g/L BDO was obtained from 148.3g/L lactose (Fig.5b). The productivity and yield of BDO were 2.73g/L/h and 0.44g/g, respectively. The major by-products in the final fermentation broth were acetate and lactate, which were found at concentrations of 3.24g/L and 0.38g/L, respectively (Additional file 1: Fig. S2b). During fermentation, agitation and airflow were set at 400rpm and 1vvm, respectively, and dissolved oxygen was uncontrolled. Acetoin started to accumulate at the end of fermentation and feeding more whey powder into the fermentation system did not increase BDO production. Dissolved oxygen has a profound impact on the distribution of BDO and its dehydrogenation product, acetoin. Since BDO biosynthesis occurs under microaerobic conditions [28, 29], fine-tuning the dissolved oxygen through an automatic control system might provide the optimal microaerobic condition to further increase BDO production.

Several microbial strains have been screened to produce BDO from whey or lactose. However, as shown in Table1, the final concentration and yield of BDO produced by wildtype isolates were relatively low. For example, Vishwakarma tried to use strain K. oxytoca NRRL-13-199 for BDO production from whey. After the addition of 50mM acetate, 8.4g/L BDO was acquired with a yield of 0.365g/g lactose [30]. Barrett et al. studied production of BDO from whey by K. pneumoniae ATCC 13882 [23]. After 60h of fermentation, 19.3g/L BDO was produced from whey with a productivity of 0.32g/L/h. Ramachandran et al. obtained a concentration of 32.49g/L BDO from lactose by using K. oxytoca ATCC 8724; however, the yield (0.207g/g lactose) and productivity (0.861g/L/h) of BDO were still unsatisfactory [31]. In a previous work, Lactococcus lactis MG1363 was metabolically engineered to produce BDO from residual whey permeate, and a final titer of 51g/L BDO was acquired [32]. Exogenous antibiotics were needed for the maintenance of two plasmids, pJM001 and pLP712, which carry the genes needed for BDO production and metabolism of lactose, respectively. To make bio-based BDO production from whey more economically efficient and environment-friendly, BDO production without antibiotic addition to the fermentation system for the maintenance of plasmids should be initiated. In this work, K. oxytoca PDL-0 was metabolically engineered to efficiently produce BDO from lactose in whey powder through deleting pox, pta, frdA, ldhD, and pflB. Using whey powder as the carbon source, the recombinant strain K. oxytoca PDL-K5 can produce 65.5g/L BDO (Table1). Compared with other strains used for BDO production from whey, the engineered strain has significant production advantages, such as high product concentration (65.5g/L), high productivity (2.73g/L/h), and lack of a need for unnecessary exogenous antibiotics.

Recently, lactose or whey have been used to produce various biochemicals, e.g., ethanol [33], butanol [34], lactic acid [35], citric acid [36], poly(3-hydroxybutyrate) (PHB) [37], and gluconic acid [38], through endogenous or exogenous biosynthetic pathways. However, because of the low utilization efficiency of lactose in these chassis cells, it is difficult to produce the target chemicals with high productivity and high yield [34, 36]. Ahn et al. constructed a fermentation strategy with a cell-recycle membrane system for the production of PHB from whey [37]. A high consumption rate of lactose (7.67g/L/h) was acquired using this complicated fermentation strategy. The engineered strain K. oxytoca PDL-K5 in this study had the ability to efficiently transform lactose in whey powder into BDO with relatively high yield (0.44g/g) and high consumption rate of lactose (6.18g/L/h). This work provides a suitable method for BDO production as well as whey utilization (Fig.6). Considering its excellent characteristics of non-pathogenicity (Risk Group 1) and efficient lactose utilization, K. oxytoca PDL-0 may be a promising chassis for production of various chemicals from whey through metabolic engineering. For example, acetoin, the oxidized precursor of BDO, might be produced through increasing dissolved oxygen levels and deleting 2,3-butanediol dehydrogenases responsible for BDO production from acetoin [39].

In this study, the ability of K. oxytoca PDL-0 to metabolize lactose and produce BDO was identified. Then, by-product pathways encoding genes in K. oxytoca PDL-0 were knocked out to improve the yield of BDO. The engineered strain K. oxytoca PDL-K5 was able to utilize whey powder as the substrate for high production of BDO. The fermentative process developed here is a promising alternative method for both biotechnological production of BDO and whey utilization. In addition, other important chemicals may also be produced from whey using metabolically engineered K. oxytoca PDL-0, which has the characteristics of efficient lactose utilization.

FastPfu DNA polymerase was purchased from TransGen Biotech (Beijing, China) and T4 DNA ligase from Thermo Scientific (Lithuania). Restriction enzymes were purchased from TaKaRa Bio Inc. (Dalian, China). Polymerase chain reaction (PCR) primers were provided by Tsingke Biology Co., Ltd (QingDao, China). Racemic acetoin and BDO was purchased from Apple Flavor & Fragrance Group (Shanghai, China) and ACROS (The Kingdom of Belgium), respectively. Whey powder with a lactose content of 77% was purchased from KuoQuan Biotech (Shandong, China). All other chemicals were of analytical grade and commercially available.

The strains and plasmids used in this study are listed in Table2. All engineered strains used in this work are based on K. oxytoca PDL-0 and its derivatives. E. coli S17-1 was used to hold and amplify plasmids as well as for conjugation with K. oxytoca. The plasmid pKR6KCm was used for gene knockout in K. oxytoca [27].

LuriaBertani (LB) medium was used for the cultivation of all the strains used. The M9 minimal medium [40] supplemented with 5g/L yeast extract and 40g/L lactose was used in shake flasks experiments for selection of the efficient BDO producing strain. The selection medium for single exchange strains of K. oxytoca was M9 minimal medium supplemented with 20g/L sodium citrate and 40g/mL chloramphenicol. The selection medium for double exchange strains of K. oxytoca was solid LB medium supplemented with 15% sucrose.

The primers used for knockout of byproduct-producing genes in K. oxytoca PDL-0 are listed in Additional file 1: Table S1. Vector isolation, restriction enzyme digestion, agarose gel electrophoresis, and other DNA manipulations were carried out using standard protocols [41]. Knockout mutants of K. oxytoca PDL-0 were generated via allele exchange using the suicide plasmid pKR6KCm [27]. The left and right flanking sequences were amplified from K. oxytoca PDL-0 and then ligated through PCR to get pox fragment using primer pairs Ppox.f (EcoRI)/Ppox.r (overlap) and Ppox.f (overlap)/Ppox.r (BamHI), respectively. The gel-purified pox fragments were ligated to the pKR6KCm digested with EcoRI and BamHI. The resulting plasmid was designated pKDpox and introduced into E. coli S17-1. Then, a three-step deletion procedure was applied to select the pox mutant after conjugating the pKDpox in K. oxytoca PDL-0 as described previously [27]. The pta, frdA, ldhD, and pflB mutants of strain K. oxytoca PDL-0 were generated by using the same procedure and primers listed in Additional file 1: Table S1.

Batch fermentations were conducted in a 1-L bioreactor (Multifors 2, Infors AG, Switzerland) with 0.8L of medium. The seed culture was inoculated (10%, v/v) into the fermentation medium containing 8.27g/L corn steep liquor powder (CSLP); 4.91g/L (NH4)2HPO4; 3g/L sodium acetate; 0.4g/L KCl; 0.1g/L MgSO4; 0.02g/L FeSO47H2O; 0.01g/L MnSO47H2O and 40g/L lactose. The cultivation was carried out at 37C, stirring at 400rpm, airflow at 1.0vvm and initial pH of 7.0. When pH dropped to 6.0, it was maintained at this level by automatic addition of 4M H3PO4 or 5M NaOH. Fed-batch fermentation was carried out in a 7.5-L fermenter (BioFlo 310, NBS, USA) containing 5L of medium and the cultivation condition was the same as 1-L fermenter except that the initial concentration of lactose was about 100g/L. Alternatively, 130g/L whey powder was fed into the fermentation broth to make the initial concentration of lactose at about 100g/L. Solid lactose or whey powder was fed in the fermenter when residual lactose concentration was reduced to about 20g/L.

The optical density (OD) was measured at 600nm using a spectrophotometer (V5100H, Shanghai Metash Instruments Co., Ltd, China) after an appropriate dilution. The concentrations of lactose and other by-products were detected by high performance liquid chromatography (HPLC) in an Agilent 1100 series, equipped with a Aminex HPX-87H column (3007.8mm; Bio-Rad, USA) and a refractive index detector [40]. The mobile phase was 10mM H2SO4 at a flow rate of 0.4mL/min at 55C. The concentrations of acetoinand BDO were analyzed by gas chromatography (GC) (Shimadzu, GC2014c) using a capillary GC column (AT. SE-54, inside diameter, 0.32mm; length, 30m, Chromatographic Technology Center, Lanzhou Institute of Chemical Physics, China). Prior to GC analysis, the sample was extracted by ethyl acetate with isoamyl alcohol as the internal standard. Nitrogen was used as the carrier gas for GC analysis. The temperature of both the injector and the detector was 280C, the column oven was maintained at 80C for 3min. Statistical analysis of the results was conducted using Origin 9.0 (OriginLab, USA). Unless otherwise specified, data are shown as the meanS.D. (standard deviations) from three independent experiments.

Domingos JMB, Martinez GA, Scoma A, Fraraccio S, Kerckhof FM, Boon N, Reis MAM, Fava F, Bertin L. Effect of operational parameters in the continuous anaerobic fermentation of cheese whey on titers, yields, productivities, and microbial community structures. ACS Sustain Chem Eng. 2017;5:14007.

Asunis F, De Gioannis G, Isipato M, Muntoni A, Polettini A, Pomi R, Rossi A, Spiga D. Control of fermentation duration and pH to orient biochemicals and biofuels production from cheese whey. Bioresour Technol. 2019;289:121722.

Cho S, Kim T, Woo HM, Lee J, Kim Y, Um Y. Enhanced 2,3-butanediol production by optimizing fermentation conditions and engineering Klebsiella oxytoca M1 through overexpression of acetoin reductase. PLoS ONE. 2015;10:e0138109.

Jantama K, Polyiam P, Khunnonkwao P, Chan S, Sangproo M, Khor K, Jantama SS, Kanchanatawee S. Efficient reduction of the formation of by-products and improvement of production yield of 2,3-butanediol by a combined deletion of alcohol dehydrogenase, acetate kinase-phosphotransacetylase, and lactate dehydrogenase genes in metabolically engineered Klebsiella oxytoca in mineral salts medium. Metab Eng. 2015;30:1626.

Haider J, Harvianto GR, Qyyum MA, Lee M. Cost- and energy-efficient butanol-based extraction-assisted distillation designs for purification of 2,3-butanediol for use as a drop-in fuel. ACS Sustain Chem Eng. 2018;6:1490110.

Wang A, Xu Y, Ma C, Gao C, Li L, Wang Y, Tao F, Xu P. Efficient 2,3-butanediol production from cassava powder by a crop-biomass-utilizer, Enterobacter cloacae subsp. dissolvens SDM. PLoS ONE. 2012;7:e40442.

Li L, Li K, Wang Y, Chen C, Xu Y, Zhang L, Han B, Gao C, Tao F, Ma C, Xu P. Metabolic engineering of Enterobacter cloacae for high-yield production of enantiopure (2R,3R)-2,3-butanediol from lignocellulose-derived sugars. Metab Eng. 2015;28:1927.

Moon SK, Kim DK, Park JM, Min J, Song H. Development of a semi-continuous two-stage simultaneous saccharification and fermentation process for enhanced 2,3-butanediol production by Klebsiella oxytoca. Lett Appl Microbiol. 2018;66:3005.

Saratale RG, Shin HS, Ghodake GS, Kumar G, Oh MK, Saratale GD. Combined effect of inorganic salts with calcium peroxide pretreatment for kenaf core biomass and their utilization for 2,3-butanediol production. Bioresour Technol. 2018;258:2632.

Guo XW, Zhang YH, Cao CH, Shen T, Wu MY, Chen YF, Zhang CY, Xiao DG. Enhanced production of 2,3-butanediol by overexpressing acetolactate synthase and acetoin reductase in Klebsiella pneumoniae. Biotechnol Appl Biochem. 2014;61:70715.

Champluvier B, Francart B, Rouxhet PG. Co-immobilization by adhesion of -galactosidase in nonviable cells of Kluyveromyces lactis with Klebsiella oxytoca: conversion of lactose into 2,3-butanediol. Biotechnol Bioeng. 1989;34:84453.

Xin B, Tao F, Wang Y, Liu H, Ma C, Xu P. Coordination of metabolic pathways: enhanced carbon conservation in 1,3-propanediol production by coupling with optically pure lactate biosynthesis. Metab Eng. 2017;41:10214.

Heyman B, Tulke H, Putri SP, Fukusaki E, Bchs J. Online monitoring of the respiratory quotient reveals metabolic phases during microaerobic 2,3-butanediol production with Bacillus licheniformis. Eng Life Sci. 2020;20:13344.

Rebecchi S, Pinelli D, Zanaroli G, Fava F, Frascari D. Effect of oxygen mass transfer rate on the production of 2,3-butanediol from glucose and agro-industrial byproducts by Bacillus licheniformis ATCC9789. Biotechnol Biofuels. 2018;11:145.

Qureshi N, Friedl A, Maddox IS. Butanol production from concentrated lactose/whey permeate: use of pervaporation membrane to recover and concentrate product. Appl Microbiol Biotechnol. 2014;98:985967.

Roukas T, Kotzekidou P. Lactic acid production from deproteinized whey by mixed cultures of free and coimmobilized Lactobacillus casei and Lactococcus lactis cells using fedbatch culture. Enzyme Microb Technol. 1998;22:199204.

Arslan NP, Aydogan MN, Taskin M. Citric acid production from partly deproteinized whey under non-sterile culture conditions using immobilized cells of lactose-positive and cold-adapted Yarrowia lipolytica B9. J Biotechnol. 2016;231:329.

We also thank Chengjia Zhang and Nannan Dong from Core Facilities for Life and Environmental Sciences (State Key Laboratory of Microbial Technology, Shandong University) for assistance in microbial fermentation.

This work was supported by the National Natural Science Foundation of China (31670041), the Grant of National Key R&D Program of China (2019YFA0904900, 2019YFA0904803), Shandong Provincial Funds for Distinguished Young Scientists (JQ 201806), Natural Science Foundation of Shandong Provincial (ZR2018PC008), Key R&D Program of Shandong Provincial (2019GSF107034, 2019GSF107039) and Qilu Young Scholar of Shandong University. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

State Key Laboratory of Microbial Metabolism, Joint International Research Laboratory of Metabolic & Developmental Sciences, and School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai, 200240, Peoples Republic of China

CG, CL and CM designed this study. WM, YZ, MC and WZ conducted the research. WM, YZ, MC, CY and PX analyzed the data. CG, CM, PX and WM wrote the manuscript. All authors read and approved the final manuscript.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Meng, W., Zhang, Y., Cao, M. et al. Efficient 2,3-butanediol production from whey powder using metabolically engineered Klebsiella oxytoca. Microb Cell Fact 19, 162 (2020). https://doi.org/10.1186/s12934-020-01420-2

By using this website, you agree to our Terms and Conditions, California Privacy Statement, Privacy statement and Cookies policy. Manage cookies/Do not sell my data we use in the preference centre.

keybank | banking, credit cards, mortgages, and loans

keybank | banking, credit cards, mortgages, and loans

During a year when COVID-19 altered nearly every aspect of our daily lives, the pandemic also put Americans financial preparedness skills to the test. But the lessons we learned about how to manage our personal finances are principles that stand the test of time.

While many Americans continue to wait out the global pandemic, one activity that should not be delayed is preparing your tax return. In fact, this year, the smartest advice may be to get prepared early. With more than 153 million people having received stimulus payments in 2020, and tens of millions of people having received unemployment benefits, there are new tax implications to consider.

zillow: real estate, apartments, mortgages & home values

zillow: real estate, apartments, mortgages & home values

Zillow Group is committed to ensuring digital accessibility for individuals with disabilities. We are continuously working to improve the accessibility of our web experience for everyone, and we welcome feedback and accommodation requests. If you wish to report an issue or seek an accommodation, please let us know.

Zillow, Inc. holds real estate brokerage licenses in multiple states. Zillow (Canada), Inc. holds real estate brokerage licenses in multiple provinces. A list of our real estate licenses is available here.TREC: Information about brokerage services, Consumer protection noticeCalifornia DRE #1522444Contact Zillow, Inc. Brokerage

For listings in Canada, the trademarks REALTOR, REALTORS, and the REALTOR logo are controlled by The Canadian Real Estate Association (CREA) and identify real estate professionals who are members of CREA. The trademarks MLS, Multiple Listing Service and the associated logos are owned by CREA and identify the quality of services provided by real estate professionals who are members of CREA. Used under license.

metallurgist & mineral processing engineer

metallurgist & mineral processing engineer

For its extensive practical experience, 911 Metallurgisthas a clear understanding of what successful mineral processing engineering is and how to go about achieving it. Your goal is the production of a material that is marketable and returns you and your investors sustainable revenues.

Although improvements to the metallurgical processes have been made over the years the fact is that the unit operations, the machines, those too often called black boxes involved have not evolved or changed much since inception. Ore is reduced in size, chemicals are added and minerals separated and upgraded to produce a marketable product. Much of this process is mechanical and generally mistaken for some dark alchemy.We are the Anti-Alchemists.

Our vast experience has been gained through operation and start-up of both small and large scale mining/metallurgical operations in a range of commodities in thebase metals (Cu, Pb, Zn) and theprecious metals (Au, Ag,)

A solid metallurgist understands, the most important aspect of an operating process is its stability. Simple to say, but generally the most ignored in mineral processing. Linked unit operations require each to be stable, and each contains a different set of variables that have to be contended with. Thanks to some degree of stability: operating changes can be made and evaluated; increases in throughput can be made; and equipment performance improved. The more complicated the processes become, the more difficult it is to achieve and maintain stability. In mineral processing, unlike most processing operations, we have limited control of the main input, the feed ore. In most cases this inherently is variable and usually outside of the processors control.

Because you are too close to your own story, you might not see the forest for the trees and have chaos mistaken for stability. We, you, and your group have been battling plant problems for weeks, you start to accept chaos as a daily state of affair and consider it your new stability.

Each mineral processing plant is different: with varied ore types, mining equipment, and management (operating) philosophy. The evaluation and prioritisation of variables that affect the plant performance is the primary function. Implementing changes within the constraints imposed can be difficult, as resources may be limited.

Invariably the ability to solve problems can be confusing due the large numbers of variables that may impact the processes. In most cases problems are not metallurgical in nature but rather operational and mechanical. Problem solving is a process and in many operations this ability is absent. All too often many changes are made together without a solution resulting, on more confusion. Most plants learn to live or survive their problems, not to solve them.

Our engineering team has a global experience in the mining industry across all facets of the mine life-cycle. Our focus is to add value to your project and company by understanding your needs, employing innovative ideas and applying sound engineering while maintaining an economically driven approach. We have a combination of senior level professionals, experienced project managers, and technical staff to execute projects efficiently. We work in a partnership with our clients to achieve their company goals and operational milestones in a timely and cost effective manner.

gold shaker tables

gold shaker tables

911Metallurgist is a recognized supplier of high-quality shaker tables that are precision-made to produce the best gravity separation. Our team of experienced engineers manufactures and assembles our tables at the suppliers factory site where the machines are built to very high standards under strict quality control conditions. The tables are constructed of the highest quality materials on the market and have been tried and tested in the field over many decades. Shaking tables provide the most efficient gravity separation of sub 2mm materials. With over a century of use concentrating minerals, 911Metallurgist units have proved themselves as the market leaders. 911Metallurgist customers are currently using tables to produce concentrates of gold (alluvial and milled ore), tin, tungsten, tantalum, and chromite, where the tables are usually used as the final stage in gravity circuits.

The most generally accepted explanation of the action of a concentrating shaker table is that as the material to be treated is fanned out over the shaker table deck by the differential motion and gravitational flow, the particles become stratified in layers behind the riffles. This stratificaton is followed by the removal of successive layers from the top downward by cross-flowing water as the stratified bed travels toward the outer end of the table. The cross-flowing water is made up partly of water introduced with the feed and partly of wash water fed separately through troughs along the upper side of the table. The progressive removal of material from the top toward the bottom of the bed is the result of the taper of the shaker table riffles toward their outer end, which allows successively deeper layer of material to be carried away by the cross-flowing water as the outer end of the shaker table is approached. By the time the end of the shaker table is reached only a thin layer, probably not thicker than one or two particles, remains on the surface of the deck, this being finally discharged over the end of the table.

The physical and mechanical principles involved in the concentrating action of a shaker table are somewhat more complicated than this explanation implies. Mathematical calculations and experimental data are extremely usefulin studying these principles, but they tell only a part of the story and do not explain the highly efficient separations that tables are known to be capable of making.

Unless the shaker table feed contains a considerable percentage of bone gold and other material of specific gravities intermediate between that of rock and gold, extremely high tabling efficiencies may be expected. If a shaker table could be operated on feed consisting of nothing but a mixture of individual gold and slate particles with a size range of approximately -in. to 48 mesh, an almost perfect separation would be obtainable even on an unclassified feed. With such a feed a well-operated shaker table would probably recover not less than 98 per cent of the gold while eliminating not less than 95 per cent of the slate. This implies almost perfect stratification according to specific gravity without regard to particle size, and it is improbable that it could be attained entirely as a result of the motion of the deck and the flow of water in a plane parallel to the deck surface.The question then arises as to what the other forces or factors are that might contribute significantly to the efficiency of the separation on a table.

As far as is known, no exhaustive studies have ever been made of the principles involved in shaker table concentration by either ore-dressing or gold-preparation engineers. Bird and Davis probably have given more attention to the subject than anyone else, but their experimental work was of a preliminary nature. It was done on minus 4-mesh raw gold and on synthetic mixtures of various products derived from this raw gold by screen sizing and sink-and-float fractionations. They used an apparatus which they called a stratifier. This was a channel-shaped box 12 ft. long, 5 in. deep and 1 in. wide, inside measurements. It was suitably mounted with one end attached to an eccentric and pitman. Stratification experiments were made by filling the box with gold and water and running it at a speed of 360 strokes per minute with the eccentric set to give -in. stroke. The amount of water used was sufficient to permit complete mobility in the bed during the operation of the stratifier. At the end of each run, after the water had been allowed to drain off, one side wall of the stratifier was removed and cross-section samples were taken of the bed to determine by screen-sizing and sink-and-float tests to what extent stratification had been accomplished. Bird and Davis say that their aim is to bring out the fact that stratification, contrary to the common brief, will not account for the separation effected by the gold-washing table, and that cross-flowing water, in addition to removing the top strata found on the table, must also have an important selective action in completing the separation according to specific gravity, both in the upper and in the lower strata found between riffles.

The theory of Bird and Davis as to the selective action of the crossflowing water is that only a part of the water flows over the top of the bed between riffles; the remainder flows through interstices in the bed. These interstices are comparatively large near the top of the bed but become progressively smaller toward the bottom, thus forming in effect V-shaped troughs. In this way the water currents would be relatively swift near the top of the bed and become progressively slower toward the bottom. According to Bird and Davis, With paths for the water such that the top strata are subjected to relatively swift currents and the lower strata are subjected to progressively slower currents, the separation actually occurring on the shaker table can be explained. As the coarse particles at the top receive swift currents and each successively finer size at the lower levels receives slower currents, the velocity of the water matches the size of materials comprising the different strata. Under these conditions a separation occurs in the lower strata similar to that in the top strata, only it takes place more slowly. The slow currents of water within the bed carry the fine gold particles along from riffle to riffle, at a more rapid rate than they do the fine bone and shale particles.

Although stratification due to the nearly horizontal action of the shaker table deck and the flow of water in a plane parallel to it is probably not sufficient to account entirely for the separation made by a table, it is, nevertheless, the fundamental principle of the shaker table just as hindered settling is the fundamental principle of a jig. Although these processes are of diametrically opposite characteristics, there is some possibility that a shaker table may utilize to a minor extent the hindered-settling principle. For convenience in this discussion, the stratification due to the more or less horizontal action of the shaker table deck and flow of water will be referred to as shaker table stratification. This type of stratification is illustrated by the separation that takes place when a box of large and small marbles is shaken and agitated in a horizontal plane in such a way that the large and small marbles collect into separate layers. It is a familiar phenomenon that the small marbles will collect in a layer on the bottom while the large marbles collect in a top layer. The principle of hindered settling can be illustrated by placing a mixture of large and small marbles in an upright cylinder of suitable size with a perforated-plate bottom. If water of sufficient volume and pressure is forced upward through the perforated plate so as to keep the marbles in teeter for a short interval, the marbles will separate into layers, with all the large marbles in the bottom layer and all the small ones on top. The separation is the reverse of that obtained by shaker table stratification. In these illustrations of stratification and hindered settling it is assumed that the marbles are all of the same specific gravity regardless of size. If some marbles have higher specific gravities than others the effect will be to increase their tendency to settle toward the bottom, regardless of whether this tendency favors or opposes the stratification or hindered-settling action. The heavier the small marbles, the easier the separation by shaker table stratification and the more difficult by hindered settling. Conversely, the heavier the large marbles, the more difficult the separation by shaker table stratification and the easier by hindered settling.

In line with principles referred to above, complete separation according to specific gravity could hardly occur on a shaker table or in any other concentrating device as a result of either shaker table stratification by itself or hindered settling by itself when the material to be separated consists of particles varying a great deal in both size and specific gravity. In gold washing the aim is to separate gold particles from particles of refuse according to specific gravity without reference to size of particles, as the ash content of a particle is almost directly proportional to its specific gravity. This separation can be accomplished more effectively by utilizing a combination of shaker table stratification and hindered settling than by relying on either of these two alone, and it is quite conceivable that both processes actually do play a part in the operation of a concentrating table.

To explain how a certain degree of hindered settling might occur on a table, we must assume, as Bird and Davis did, that although a part of the water flows across the top of the bed the remainder of it flows through interstices in the bed itself between adjacent riffles. This seems to be a reasonable assumption and it is one that is also made by Taggart in his discussion of the theory of shaker table concentration. The cross flow of water from one riffle to the next might be somewhat as illustrated in Fig. 8, in which a-b is a line along the surface of the deck perpendicular to the riffles, and C and D are two successive riffles. If the bed is kept in a mobile condition between riffles by the motion of the table, and if the water flows from riffle to riffle approximately as indicated in Fig. 8, it is quite probable that to a certain degree a hindered-settling effect is attained along the upper side of each riffle in a zone indicated by the arrows in Fig. 8. Although the effect of hindered-settling along any individual riffle might be relatively slight, the cumulative effect along the entire series of riffles across the width of the deck might be of sufficient magnitude to influence materially the character of the shaker table separation.

We should expect a hindered-settling effect to be very beneficial as an ally to stratification on a table. The weak point about shaker table stratification is that it tends to deposit all fines at the bottom of the bed, even fine gold of low specific gravity. This fine gold, after penetrating to the surface of the deck, would be guided toward the refuse end by the riffles and would tend to go into the refuse if it were not brought to the top of the bed by some means or other and then carried over the riffles by the cross flow of water and subsequently discharged with the washed gold. Bringing the fine gold to the surface is a function that hindered settling would accomplish very effectively, as one of the fundamentals of hindered settling is that it brings the light, fine particles to the top of the bed. As far as the coarse particles of gold are concerned, evidently they are brought to the surface by stratification and started on their way to the washed-gold side of the shaker table by the cross flow almost instantly after the feed strikes the deck. Anyone who has operated a gold-washing shaker table is familiar with the rapidity of this separation and the way in which it causes all light, reasonably coarse gold particles to be discharged from a rather narrow zone at the head-motion end.

If the suppositions in the foregoing paragraph are correct, the process of separation of gold and refuse on a shaker table may be summarized as follows: Almost immediately after the feed strikes the table, sufficient stratification takes place to bring all coarse, light particles of gold and possibly some coarse particles of refuse to the top of the bed. The cross flow of water carries the coarse gold particles across to the gold-discharge side very rapidly, whereas any coarse particles of refuse at the top of the bed are carried toward the refuse end much more rapidly by the differential motion of the shaker table than they can be transported transversely by the cross flow of water. After removal of the coarse gold, and as the bed progresses diagonally across the table, the shaker table stratification action brings medium-sized gold particles to the surface, and these are removed across the tapering riffles by the wash water. The tapering riffles and continuous removal of material by the cross flow causes the bed to become thinner and thinner toward the refuse end. When the point is reached where the thickness of the bed is less than that of the coarse refuse particles, these particles stick up through the surface of the bed and the transverse pressure exerted on them by the cross flow is diminished, as their surfaces are only partly exposed to this flow. This helps to keep them on their course toward the end of the shaker table and prevents them from being transported by the water in the same direction as the medium-sized gold. Toward the outer end of the riffles the extremely fine gold is being brought to the surface by a hindered-settling action immediately behind each successive riffle. Since the material subjected to this action consists of light, fine particles of gold and heavy refuse of a much larger average particle size, the action should be particularly effective in bringing the fine gold to the surface and allowing it to be carried off into the washed gold by the wash water.

This explanation presumes that to some extent there is a greater opportunity for hindered-settling conditions toward the outer end of each riffle than near the head-motion end. Although this presumption may be questionable, it is possible that, as the bed becomes thinner, a greater proportion of the water follows a coarse along the surface of the deck and contributes to the upward current required for hindered-settling conditions as each riffle is encountered.

In this discussion of shaker table principles shape of particle has been disregarded because it is believed that, as a rule, this is not an important factor in the gold-tabling process. Almost invariably the gold particles are somewhat more cubicle and less platy or flaky than refuse particles, but there is little evidence to show that refuse particles of one particular shape are more difficult to separate on a shaker table than those of some other shape. As for the gold, the shape of particles in sizes suitable for tabling are pretty much alike in all golds. Yancey made a study of the effect of shape of particle. He decided that, for the gold he used in his study, shape of particle is a factor of minor importance in tabling this unsized gold, in so far as the over-all efficiency of the process is concerned. Size and, of course, specific-gravity difference are the major factors.

Of considerably more importance than shape of particle is the particle-size factor. It is evident from the nature of stratification and hindered settling that the separation of gold from refuse becomes more difficult as the range of sizes to be treated in one operation increases. The increasing difficulty as the size range increases is apparent from the following considerations: Assume that we are dealing with two minerals, one of high and one of low specific gravity, and that a mixture of 10-mesh particles of the two minerals will separate readily into two layers by either shaker table stratification or hindered settling, one layer containing all the light particles and the other layer all the heavy particles. Now, if we add two more sizes of heavy particles to the mixture, say 8-mesh and 14-mesh particles, obviously, according to the principles of stratification and hindered settling, the separation by either process into two layers according to the specific gravities of the two minerals will be somewhat more difficult than with the original mixture of nothing but 10-mesh particles. The greater the number of sizes of heavy mineral added to the mixture, the more difficult will be the separation. This reasoning applies likewise to the particles of the light mineral, and it all sums up to the fact that if a shaker table feed contains too wide a range of sizes some of the sizes will be cleaned inefficiently.

In actual practice there is no objection to a considerable variety of sizes in the feed; in fact, if all particles were of the same size there might be some disadvantages, because the bed would be less mobile and less fluid and conditions within the bed would be less favorable for efficient separation than when there is some variety of sizes. For efficient shaker table operation, however, it is important to guard against having too wide a range of sizes in the feed.

In the use of tables in gold preparation, the importance of correct operating conditions can hardly be overemphasized. It is a peculiarity of tables that they give excellent results when correct operating conditions are maintained, but with conditions upset and unbalanced the results are likely to be as far on the bad side as they were on the good side under favorable conditions. This is especially true if the washing problem is somewhat difficult. Naturally, when there is an almost complete absence of bony material in the shaker table feed and the problem is mainly one of separating low-ash gold from slate and other rock, fair results may be obtained even under haphazard operating conditions; but if the washing problem is at all difficult the results are likely to be either extremely good or extremely bad, depending on whether or not correct operating conditions are adhered to. Some of the factors on which operating conditions are dependent will be discussed briefly.

It is a comparatively simple matter to build foundations substantial enough so that they will not have a tendency to shake or vibrate as a result of the motion of the tables. A reinforced-concrete slab need not be more than 6 or 7 in. thick to provide a perfectly rigid foundation, even at a considerable height above the ground, if properly supported on reinforced concrete pillars. It is important to provide tables with substantial, rigid foundations that will not deteriorate after a few years of service. Even a slight shaking or vibrating motion in the foundations is likely to interfere with the action of the tables and lead to serious loss of shaker table efficiency.

One of the first essentials for successful shaker table operation is uniform flow of gold and water to the table. The significance of a steady, uniform feed is apparent from a consideration of the mechanical process involved in the shaker table separation of gold from refuse. The material fed to a shaker table spreads out in a fan-shaped bed. This bed covers virtually the entire shaker table deck. Along the outer edges of the bed at the points of discharge the refuse has separated from the gold and discharges over the end of the shaker table while the gold discharges over the side, assuming that the corner of the shaker table is the dividing point between gold and refuse. However, the amount of material discharging over the side of the shaker table in proportion to that discharged over the end will vary if the rate of feed varies and other conditions remain constant. For instance, if a shaker table is set to give highly efficient results with a feed of 7 tons per hour of a given gold, it will discharge approximately the correct percentage by weight over the refuse end as refuse. If the feed is decreased by several tons per hour, however, without any compensating adjustments being made, a larger percentage of the total material is likely to discharge over the refuse end. This means an unnecessary loss of gold and a low shaker table efficiency. If the feed should be increased by several tons per hour the reverse of this probably would happen, with a certain amount of refuse going into the washed gold and raising its ash content.

Variations in feed rate also affect adversely the conditions for separation of gold from refuse within the bed itself. For instance, for any particular setting of the shaker table when a given gold is treated there is an optimum thickness of bed and an optimum ratio of water to solids in the feed that should be observed when high shaker table efficiency is important. The process of separating particles of refuse from particles of gold cannot be highly efficient except under these optimum conditions, and it is quite obvious that if the feed rate decreases it will tend to decrease the thickness of the bed in certain areas on the table, and the ratio of water to solids will change, as the amount of feed water and wash water are usually more or less independent of the tonnage of solids in the feed. Such interference with the actual separating function of the shaker table is likely to cause an incomplete separation.

With further reference to optimum separating conditions within the bed itself, it is important to maintain always the right kind of distributionthe term distribution in this connection referring to the shaker table distribution of the material with which the constantly moving bed on the shaker table is maintained. The shaker table distribution should be such that the quantity of solids discharged per unit length along the side of the shaker table decreases gradually from the head-motion end toward the refuse end. It should be observed in qualification of this statement, however, that it is usually advantageous to have the washed-gold discharge start at a point a foot or so away from the cornerthat is, the corner directly across from the feed box. Usually there is a large volume of water discharging from this corner zone, but ordinarily it is preferable to have almost no solids discharging with it. Beginning at the end of this corner zone, however, there should be a very heavy discharge of washed gold in the first 3 or 4 ft., and the amount discharged from each successive zone from there to the corner at the refuse end should decrease gradually. There should be some discharge of solids virtually all the way to the corner, but as the corner is reached the discharge should be almost zero. Under these conditions there will always be some refuse material discharging immediately around the corner, but the amount of refuse from the first 6 or 8 in. next to the corner on the refuse end should be negligible in quantity. The bulk of the refuse should discharge over a zone of considerable width, starting not less than 1 or 2 ft. up from the corner.

Although this more or less ideal distribution is fairly easy to attain with an average raw-gold feed, it may be more difficult of attainment with a type of feed in which there is an abnormally high percentage of refuse, especially if the refuse consists mostly of high-ash bone gold. This condition often is encountered in the re-treatment of middlings from primary stages of washing.

However, regardless of the character of the feed, the nearer this ideal distribution is approached, the better the results will be. Once the correct balance between shaker table adjustments and the volume of feed gold, feed water, and wash water has been found, good distribution will maintain itself automatically as long as none of the operating factors are allowed to change. It is self-evident, however, that an increase or decrease in the amount of water going to the tableeither feed water or wash waterwill upset this distribution just as quickly as a change in the feed tonnage unless other compensating adjustments are made.

It is of paramount importance, therefore, to have a feed system that will eliminate as far as possible fluctuations or variations in the rate at which gold and water are fed to the table. With regard to the gold, not only the quantity but also the quality and physical characteristics should be kept constant. This is true particularly with reference to the size distribution of the feed. Any change in size distribution, such as may result from segregation in an improperly designed bin ahead of the tables, can upset the distribution of the material on the tables. The only sure way to get a steady feed is to feed the gold to the shaker table by means of a positive-type feeder, such as a belt, screw conveyor, apron feeder, or rotary star or paddle feeder. A sliding gate device instead of mechanical feeders is almost certain to be unsatisfactory, even when a water line can be placed inside the gate to keep the material moving. The mechanical feeders should be provided with variable-speed drive for adjusting the feed to the desired tonnage. This adjustment cannot be made satisfactorily by varying the size of the opening through which the gold discharges onto the feeder. The feed bin should be of such size and design as to eliminate segregation as far as possible. Any attempt to dispense with feed bins is likely to result in unsatisfactory operating conditions, although it is being done at many plants. A customary practice, for instance, is to draw a middling product from a set of jigs and after dewatering run it through a crusher directly to the tables. Such procedure nearly always provides a variable feed for the tables whereas a constant feed could be obtained by dropping the discharge from the crusher into a bin and having mechanical feeders between the bin and the tables.

Changes in the size distribution of a feed are sometimes caused by difficulties in the dry screening of run-of-mine gold. If dry screening is used and the amount of surface moisture in the run-of-mine gold varies, a finer shaker table feed will be produced when the gold is excessively moist than when it is dry. Naturally, particles near the upper size limit will go through the screen readily if the gold is dry whereas if the gold is wet these particles are likely to go into the oversize. The resultant variation in the size character of the feed can interfere with shaker table efficiency as readily as segregation in the bin. Wet screening eliminates this difficulty.

In connection with the problem of segregation and variations in the size-consist of shaker table feed, a comparatively recent development at a shaker table plant in Alabama is worth noting. This plant went into operation at the Praco mine of the Alabama By-Products Corporation in 1944. Incorporated in this plant is a newly-designed system for reducing to a minimum the problem of segregation. The 16 tables in this plant are provided with small individual feed hoppers of about 1500 lb. capacity. Transfer of the 7/16 in- to 0 shaker table feed gold to these hoppers from 100-ton storage bin is accomplished by means of a horizontally operated bucket conveyor, tradenamed Side-Kar Karrier by its manufacturer. After passing under the 100-ton storage bin where the buckets are filled up with gold through multiple openings in the bottom of the bin, this conveyor moves on a track laid in a horizontal plane across the tops of the 16 feed hoppers. Each individual hopper is spring-suspended and as gold is withdrawn out of the bottom by the shaker table feeder, the hopper rises due to decrease in weight. As it rises it automatically engages a tripping mechanism in the conveyor buckets overhead, causing the buckets to discharge their load into the hopper. Thus a few buckets at a time are dumped into each hopper and the effect of small increments dumped at frequent intervals is obtained, giving a flow of gold to each shaker table of more average and uniform size-consist than when gold is run in a continuous stream into a large feed bin until the bin is filled.

As a further deterrent to segregation, the gold is fed from the bottom of the hopper to the shaker table by means of a tapered auger so as to draw continuously from the entire width of the hopper and avoid segregation within the hopper. For further details of this plant, the reader is referred to an article published in 1944.

With regard to the water supply for a table, it is just as important to have a steady, uniform flow of water as of gold. The water pipes and valves should be so arranged in a shaker table plant that each shaker table gets its flow of water quite independently of the others. If a common water header is used it should be big enough so that, regardless of how the water adjustments are changed for one shaker table or group of tables, the volume of flow to the others will not be changed. The source of the water supply, of course, should be maintained with a fairly constant pressure or head. This can be accomplished more effectively by using a gravity tank at a considerable height above the level of the tables than by drawing water directly from a pumping circuit. Clean water is to be recommended strongly in preference to dirty water from the washer circuit. Wash water sometimes carries enough solids in suspension to interfere with the flow through pipes and valves, and accumulation of solids sometimes may stop a valve entirely. Under these conditions the flow of water varies almost continuously and there will be too much one minute and not enough the next. The solids in the water are likely also to be sufficiently abrasive so that frequent replacements of the valves and fittings will be necessary. All of these troubles can be avoided entirely by using a supply of clean water for the tables.

The riffling, shaker table speed, length of stroke, and other adjustments, such as shaker table slope, longitudinal, and cross slope, must in each case be balanced by the various other operating factors, so as to get the desired results. The speed that the shaker table manufacturer provides for when he supplies each shaker table with its individual motor drive is usually quite satisfactory. This speed is usually between 250 and 300 r.p.m. All shaker table head motions are designed so that the length of stroke is adjustable within a certain range. This range usually is from to 1 in., or slightly over. The coarsest shaker table feed requires the longest stroke. For a raw-gold feed of average size, say 5/16-in. to 0, a stroke of 7/8 to 1 in. usually is satisfactory. A slightly longer stroke on such a feed usually will give about the same shaker table efficiency with slightly higher capacity. A report giving experimental data as to the effect of speed, stroke, and other variables on shaker table efficiency has been published by the Bureau of Mines. More recent work published by the Illinois Geological Survey emphasizes the importance of the longitudinal slope and the speed of reciprocation, two factors which are not readily adjustable on ordinary commercial tables. A slower speed is found to improve the performance, in opposition to the results reported by the Bureau of Mines. The discrepancy is noted by the author, and has not been explained.

As to type of riffling, it seems to be generally agreed now that high riffles are advantageous in the tabling of bituminous gold, and it is customary to have the main riffles start with a height of not less than in. at the feed end and taper to a feather edge at the outer end. The -in. height probably represents a minimum; riffles 2 in. high are now used on the Deister Plat-O tables; and these tables are recommended by the manufacturer for the cleaning of shaker table feeds as fine as 3/8-in. to 0. There is a great deal of variation in the spacing of high riffles. In some designs there is only one shallow riffle between two higher riffles. Another design, intended to emphasize the importance of the pool effect, provides four or more shallow riffles between successive high riffles. About the only suggestion that can be made with regard to riffling is that the coarser the feed, the more advantageous are high riffles. Unless the shaker table feed is extremely fine, with maximum particles size less than in., there seems to be no good argument for the main riffles to be less than or 1 in. high. On such gold, riffles lower than this would tend to reduce capacity. With coarser feeds higher riffles can be used advantageously.

As to the comparative merits of wooden riffles and rubber riffles, one can be substituted for the other without changing the shaker table results appreciably. It seems evident, however, that the efficiency, as far as ash reduction and gold recovery are concerned, is slightly less with rubber covering and riffles than with linoleum covering and wooden riffles. The difference would be only a few tenths of one per cent less ash at the same recovery, using the linoleum and wooden riffles. Usually this is more than offset by the greater operating economy of the rubber covering and riffles. Although the rubber combination costs about twice as much as linoleum and wood, it is supposed to last 10 or 12 times as long.

In summarizing, the principal adjustments and factors to be considered in putting a shaker table into operation on a certain feed, are: feed rate, as to volume of both gold and water; slope of the shaker table (longitudinal and cross slope); riffling system, shaker table speed, and length of stroke. A shaker table installation should be so designed that any or all of these adjustments and factors can be changed easily to meet requirements during the procedure of placing the tables in operation. In starting a shaker table plant, the main objective should be to find the combination of shaker table adjustments and operating factors that will give the correct shaker table distribution described previously in the discussion of feed uniformity. The quantity of water to be used is from two to three times as much by weight as the feed of gold, but it should be adjusted as nearly as possible to the minimum amount that will keep the products discharging uniformly from all zones around the edge of the table. To most nearly attain the ideal distribution on the table, it is usually necessary to have the supporting channels under the shaker table deck several inches higher at the refuse end than at the feed end. As to the cross slope, it should be the minimum at which it is possible to attain good distribution. In other words, the flatter the shaker table is in the crosswise direction, the better, provided the distribution is good. The length of stroke and shaker table speed should be adjusted so that the bed will be kept in a state of uniform flow and mobility all over the deck. On the raw-gold feed, these operating conditions can be attained fairly easily, but it may be more difficult in the treatment of middling products. Difficulties sometimes can be overcome by making slight changes in the riffling and by use of auxiliary water sprays directed at certain areas in the bed. Anything that is done should be directed toward getting and maintaining a distribution on the shaker table as nearly ideal as possible.

The launder system in a shaker table plant should be so designed that a splitter can be used for dividing the washed gold from the refuse at some point along the washed-gold side instead of at the corner, if desired. The correct shaker table distribution will sometimes give too high an ash content in the washed gold if the split between washed gold and refuse is made at the corner, and in such instances the best solution is an adjustable divider or splitter that can be set at any desired point along the washed-gold side.

The tonnage a shaker table will handle effectively depends to a great extent on the washability and size of the gold. In treating an ordinary 5/16-in. to 0 raw-gold feed, high efficiency with respect to both cleaning and recovery usually can be obtained with a feed of as much as 10 tons per hour. High efficiency in this case means an efficiency that could not be improved appreciably by lowering the tonnage. If the gold is extremely easy to wash, higher tonnages can be cleaned with equally good efficiency. The claim sometimes is made by shaker table manufacturers that their tables will handle efficiently as much as 15 to 20 tons per hour of 5/16-in. to 0 gold. On an average feed of this size, however, feed-tonnages of more than 10 tons per hour are likely to cause a decrease in efficiency. With feeds as coarse as -in. or 1-in. to 0, it is not unusual to treat from 12 to 15 tons an hour per table. Modern tables will handle minus 1/8-in. feed at the rate of 7.5 tons per hour.

One of the important considerations frequently overlooked in the design of a shaker table plant is that the making of necessary shaker table adjustments is extremely difficult unless representative samples can be taken easily. Often the more or less permanent washed-gold and refuse launders around the tables are laid out in such a way that it is next to impossible to get dependable samples of the products from individual tables. Either the launders should be so designed that they can be partly removed during sampling, or they should be built with enough spacing between the edge of the shaker table and the launder so that the necessary sampling pans for taking zone samples can be inserted at any place around the table. Provisions should also be made for conveniently sampling the composite washed gold and composite refuse from each table, in addition to the feed to individual tables. Without dependable samples it is sometimes difficult to tell whether or not an individual shaker table is operating correctly; and, owing to the segregation of products into various discharge zones, haphazard sampling is sometimes worse than no sampling at all.

The laboratory shaking table is widely used for the gravity separation of sands too fine to treat by jigging. The physical principles utilised in tabling must be understood if preparation of feed and application of control are to be efficient.

Consider a number of spheres rolling down a slightly tilted plane under the urging influence of a flowing film of water. Some of the spheres (shaded) in Fig. 170 represent heavy mineral and others (white) light gangue. The largest sphere travels fastest and the smallest one slowest, under the combined influence of streaming action and gravitational pull. Of two spheres having the same density, the larger moves faster. Of two having the samediameter, if the slope is relatively gentle and the hydraulic urge relatively strong, the lighter sphere travels faster. If during the otherwise free downward travel of these spheres the whole plane is moved sideways, then the horizontal displacement of the spheres varies in accordance with the lengthof time they take to roll down. This is represented here on the right, which shows that the largest light sphere has undergone the least horizontal displacement because it travelled fastest, whilst the smallest heavy one has been carried furthest to one side. From this it is seen that if a suitable displacing movement can be applied to a plane, the feed can be spread into bands according to the size and density of its constituent particles. If these bands are collected into separate vessels as they leave this deck, the feed will have been segregated into three main products:

A particle light enough to respond mainly to the hydraulic influence of the flowing film of water moves down-plane with little horizontal displacement. A typical particle, unlike a sphere. will either slide or skip downward, rather than roll, provided it is reasonably free to move. Apart from the limited use of the automatic strake in concentrating metallic gold, continuous lateral displacement across the sorting plane cannot handle an adequate tonnage and is not used in the mill.

With the Laboratory shaking table a reciprocating side motion is applied to the sloping surface or deck down which the pulp is streaming. If this shaking action was applied symmetrically in both directions across the stream, each particle would move an equal distance in each direction, and separation into bands would not occur. The displacing stroke must be applied gently, so as not tobreak the grip between particle and deck. The deck accelerates, and in doing so imparts kinetic energy to the material on it. Then the deck motion is abruptly reversed so that it is snatched away from under the particles resting immediately above it. These continue to skid sideways (across the flow) until their kinetic energy has been exhausted. It is therefore essential to provide a differential side-shake which builds up gently and then breaks contact between deck and load.

This is provided by the shaking mechanism or head motion of the shaker table. The slower the particle travels downstream, the further it slides sideways under the influence of the shaking motion. Thus far discussion has been limited to a series of individual particles fed to the deck from one starting-point. If, instead, a layer several particles deep is fed from a starting-line, it becomes possible to handle a greatly increased load on the deck. The operating conditions have now changed. In the cross-section through such a layer, as seen normal to the direction of shake, the mixed feed first stratifies itself under the disturbing influence of the shaking action. The smallest and heaviest particles reach the deck, the largest and lightest stay uppermost, with a mixture of large heavy and small light grains between. This arrangement exposes the large, light particles to the maximum sluicing force of the film of water as it streams down the laboratory table. a force that can be controlled in intensity by varying the volume of water used and the slope of the deck. It is thus possible to exert some degree of skimming action to accelerate the downward movement of the uppermost layer without disturbing those below. The particles next to the deck are pressed to it by the material above, and therefore can grip it with greater firmness than would be given by their own unaided weight. They thus are able to cling during fast sideways acceleration, and are only freed and set skidding by the sudden reverse action.

The overlying particles have only a precarious hold. This aids the discriminating action of each stroke. The bottom particle travels furthest, breaks free at stroke reversal and is the first to skid. Those above it sway backward and forward and consequently receive less lateral movement. This accentuates the separating action by giving the bottom (heavy mineral) particles the maximum horizontal displacement per stroke and the upper (light gangue) grains the least. This aids the sorting discrimination. If the feed has been properly prepared by hydraulic classification, ensuring that all the grains have similar settling characteristics through vertical currents, film sizing can now take advantage of the variation in cross-section between the heavy andlight particles in each stratum, sweeping down the lighter and leaving the heavier untouched. The particles thus segregated are then removed in separately discharged fractions, called bands, at the far end of the tables deck. It would not be possible to form and maintain an evenly distributed thick bed of the kind called for by the foregoing considerations if a smooth plane deck were used. Riffles are therefore employed to provide protected pockets in which stratification can take place. They are usually straight and parallel with the direction of shake, but may be curved or slanted. The deck, instead of being plane, may be formed to provide pools in which the feed can stratify. The riffles must:

Thus (a) rules out as bad practice the use of stopping riffles set high above the rest, sometimes used to arrest and spread entering feed. If all riffles are not of similar initial height the stratifying action and transfer between them is upset. Smooth delivery is best achieved with a feed box integral with the moving deck, and aligned with the vibrator. It should let the feed down gently to the head riffles. Items (b), (c), and (d) are arguments against the use of curved riffles, which increase wall friction and upset stratifying action. A badly maintained mechanical action and deck coupling may mislead the engineer into redesigning his riffle plan, just as an incorrect stance may cause the unwary golfer to modify his swing instead of standing correctly. In the standard Wilfley table the riffles run parallel with the long axis, and are tapered from a maximum height on the feed side (nearest the shaking mechanism) till they die out near the opposite side, part of whichis left smooth. Where the riffles stand high, a certain amount of eddying movement occurs, aiding the stratification and jigging action in the riffle troughs.

As the load of material is jerked across the Laboratory Shaker Table, the uppermostlayer ceases to be protected from the down-coursing film of water, owing to the taper of the riffle. It is therefore swept or rolled over into the next riffle below. In this way the uppermost layer of sand is repeatedly sluiced with the full force of the current of wash water, riffle after riffle, until it leaves the deck. This water-film is thinnest and swiftest while climbing over the solid riffle, and the slight check and down pull it receives while passing over the trough between two riffles helps to drop any suspended solids into that trough.

At the bottom of the riffle-trough, then, the particles in contact with the deck are moving crosswise as the result of the mechanical shaking movement. At the top they are exposed to the hydraulic pressure of a controllable film of water sweeping downwards. In the trough of the riffle the combined forces-stratification, eddy action, and jigging-are arranging them according to density and volume.

Provided the entering particles have been suitably sorted and liberated, good separation can be achieved on sands in any appropriate size range from an upper limit of about i to a lower one of some 300 mesh. The difference in density and mass between particles of concentrate and gangue determines the efficient size range which must be maintained by hydraulic classification or free-fall sorting of the feed. A further separating influence is applied hydraulically along each riffle as the water in it gathers energy from the decks movement. As it gathers speed in the forward half of its cycle, the water flowing along the trough parallel to the axis of vibration is accelerated. When the decks direction is abruptly reversed this flow is only gently checked relatively to the more positive braking force exerted on the skidding particles in the riffle. There is thus a mildly pulsed sluicing action across the Laboratory Shaker Table, in addition to the steady stream at right angles to it, down-slope. This cross-stream helps the particles to travel along the riffles.Since separation depends to a large degree on the hydraulic displacement of the particle, its shape influences its reaction. Flakes of mica, though light, work down and cling to the deck, and may be seen moving nearly straight across, even at the unriffled end where they meet the full force of the stream. Where there is no marked influence in density between the constituent minerals of a pulp, the shape factor aids a flat particle to move along the deck to the concentrates zone, and under like conditions helps an equi-dimensional one to move down-slope toward the tailings discharge. Shape factor can therefore help tabling in some cases, and be disadvantageous in others, depending on whether it reinforces or opposes differences in size between the classified particles of value and tailing.

Small scale table concentration tests have many critics. Many metallurgists consider that such tests are of problematical value because of the difficulties involved in conducting and interpreting them.Many kinds of small-scale ore dressing tests are difficult to conduct, and there is, perhaps, good reason for thinking that table concentration tests are amongst the most difficult.Interpretation of results from small-scale tests is the responsibility of the metallurgists and engineers in charge, and it is often held that small-scale table concentration tests are particularly difficult to interpret.

Firstly, there are difficulties due inherently to the small-scale nature of the operations; for example the smaller width of all mineral bands on the table and the less complete separation due to the shorter length of travel between the feed and discharge points.

Secondly, there are the effects of batch operation owing to the fact that the mineral particles behave differently during the initial period when the sample is just beginning to spread over the table, the middle period when feed and discharge are even and continuous, and the final stage, when the last of the sample has been added and the table is beginning to empty itself.

If the test must be conducted as a small-scale batch test, difficulties due to the first two causes are inevitable, but by proper attention to the equipment and technique used for laboratory table concentration tests, difficulties due to inevitable causes may be minimized.

Unfortunately, it is common to find that insufficient attention has been given to the careful design of laboratory concentrating tables, and it is believed that difficulties arising from this cause, combined with crude testing techniques, are largely responsible for difficulties in interpreting results. If proper attention is given to the points mentioned, there seems no reason why the results obtained should not be a reliable guide to the optimum performance of a commercial plant.

The present paper describes the development of the concentrating table used in the laboratory operated jointly by the Mining Department of the University of Melbourne and the Ore Dressing Section of the Commonwealth Scientific and Industrial Research Organization. Although the paper contains some discussion of the technique of table concentration testing, the bulk of it is devoted to describing the steps taken to improve the mechanical rigidity of the table and the convenience of its adjustments and controls.

In order to comprehend the reason for the modifications made, it is helpful to consider, first, how a mixed feed of dense and light particles, say galena and quartz, behaves in an ordinary batch table concentration test.

It is supposed that the feed rate is uniform throughout the test and that the side slope and cross water are adjusted so that when stable conditions have been established on the table, the line of demarcation between galena and quartz will be on the concentrate end of the table 2 in. from the corner.

Galena is scarce because the quartz moves more quickly; quartz appears well up the slope of the table because the forces tending to wash it across the table are not fully operative. There is little galena on the riffled portion of the deck, so that more quartz particles remain in the riffles where they have little opportunity to be forced by the galena to the top of the bed in the riffles, from where they would be washed down by the cross water.

As the feed continues to flow, more galena appears on the table, and when stable conditions have been established, the line of demarcation between galena and quartz moves down to a point 2 in. from the corner. This condition continues until feeding ceases. Shortly it will be noted that there is scarcely any quartz on the table and that the line of demarcation between the galena and the remaining quartz moves down the concentrate end of the table towards the corner.

The first effect occurs because the quartz moves across the table more quickly than the galena. The second effect occurs because the cross water washes the galena further down the unriffled part of the deck since there is practically no quartz to stop it.

It will be found, then, that if in a batch test a table is fed- uniformly and neither the cross, water nor the side slope is altered, the line of demarcation between concentrate and tailing will start at a point well up the concentrate end of this table, move gradually to a stable point and, at the end of the test, move rather quickly to a point much closer to the corner of the table.

If a clean separation is to be obtained, it will be necessary to move a splitter to follow this line of demarcation. However, it is common to find the movement of the separation point so great that moving a splitter is not alone sufficient to cope with the large changes which occur. In this case it is necessary to alter the side slope of the table.

However, the head motion used on the laboratory table had been in service for a number of years, and had become badly worn. As alternative plans for a replacement were being considered, Mount Isa Mines Ltd. offered to donate to the laboratory a commercial Deister Plat-O head motion in excellent mechanical condition. This offer was gratefully accepted. For compactness, a frame was built to accommodate the table deck directly above the case containing the head motion, the movement being transferred through a lever arm pinned to the frame. The arrangement is illustrated in Figs. 1 and 3.

Lever arm lengths can be adjusted readily to give a stroke length ranging from 5/16 in- to 1 in. The sharpness of the kick can also be adjusted. To date no experiments on the effect of either of these variables have been conducted. The speed is constant at about 300 strokes per min. and adjustment can only be effected by changing the driving pulley.

The frame is of welded construction. The base is made of 5 in. channels, and the rest of the frame of 3 in. channels and 2 in. and in. angles. The ample sections combined with the cross-bracing give a rigid frame.

A deck of this kind has only one major defect for test workthe difficulty of avoiding contamination of successive runs owing to solids lodging between the riffles and the linoleum surface. This trouble has been minimized by using a waterproof adhesive as well as the nails to attach the riffles. Another source of contamination in the old model table was a flat-bottomed feed box which was difficult to clean. The feed box now used was made from a short length of 1 in. dia. pipe and may be seen in Fig. 1. This type of feed box is very easy to clean.

The deck is supported on four slipper rods which slide in seats arranged in independent pairs at each end of the table. Each pair of seats can move freely about a pivot, the pivots being aligned accurately. This arrangement provides a very rigid support, which accommodates itself easily to change of slope. A clear view of the rods may be seen at A, in Fig. 2, while the seats may be seen at A in Fig. 3.

The deck is connected to the head motion through a shackle and pin, (A and B, Fig. 5), while a spring attached at an angle beneath the deck keeps the slipper rods seated. A crank operated by hand-lever (A in Fig. 4) applies tension to the spring. Either one of two decks with slightly different riffling may be used. To remove the deck, spring tension is released by turning the hand-lever, and detaching the spring. The pin A (Fig. 5) is removed from the shackle B and the deck lifted off. To fit the other deck, these operations are repeated in reverse order. The changing of decks can be effected in about two minutes.

The table is provided with two adjustable splitters, a concentrate-middling splitter on the concentrate end of the table, and a middling-tailing splitter on the tailing side of the table. An external view of the splitters is shown in Fig. 6.

The concentrate end of the table is faced with a 1 in. wide strip of 16 gauge brass sheet, its edge being flush with the edge of the linoleum deck surface. The splitter itself is a vertical sheet of brass, the top edge of which is about 3/8 in. below the deck surface. The splitter and its small attached launder are mounted on a split block which slides along two brass rods mounted on brackets underneath the table. The halves of the block are held against the rods by crossed leaf springs tensioned by a small knurled nut. The method of attachment is shown in Fig. 2. The cutter moves readily when slight pressure is applied, and maintains any set position.

The cross slope of the table is adjusted by a lever arm attached to the pair of slipper rod seats at the concentrate end. A second lever operates a locking nut at the back of the pivot. The two lever arms are shown in Fig. 4. When using this simple two lever arrangement, it has been found that when the locknut is released the cross slope of the table may change suddenly and jerkily. To improve this feature, a vertical screw type of adjustment is being attached to the lever arm B.

When the cross slope of the table is changed, a couple is applied to the bridge bar (D, Fig. 2) connecting the two slipper rods at the head motion end. To avoid applying a twist to the shackle E, the nut F tightens onto a shoulder on the pin G and not onto the bridge bar. The clearance is so small (0.001 in.) that there is no perceptible slackness although the shackle can twist quite freely.

The top edge of the table deck is not parallel to the axis about which the deck is tilted. Consequently, if the launder distributing cross water were attached to the deck, the water distribution would change when the cross slope was changed. To avoid this, the launder has been attached to the main frame by two pieces of 1 in. x 3/16 in. flat steel bent appropriately. The launder is attached by hinges and may be folded up out of the way to facilitate changing of decks. The method of attaching the water launder is made clear in Fig. 4.

A common method of feeding a table for batch test work is by scoop. The discussion given of the behaviour of dense and light minerals in a batch test in which the feed is quite regular enables conditions to be foreseen when the table is fed by scoop. Suppose a somewhat extreme example in which a scoopful is fed onto the table in five seconds, and successive scoopsful added every 30 seconds subsequently. In the period immediately after adding each scoopful, the quartz added will move more rapidly than the galena, and so will push the line of demarcationbetween concentrate and tailing up. Subsequently, the corresponding amount of galena will arrive at the table edge, and so will push the line of demarcation down. This cycle will be repeated for each scoopful added. The result will be that the line of demarcation between concentrate and tailing will fluctuate. The extent of the movement will depend on the irregularity of the feed, and although with care the fluctuation may be minimized, the operation will inevitably be tedious and time-consuming, and even the best result will leave much to be desired.

Experiments with a launder feeding method have shown that it has decided advantages. The V-bottom launder used is shown in Fig. 1. The feed is spread fairly uniformly along the bottom of the launder, and the rate of feed regulated by the rate of feeding water to the head of the launder. About 90% of the feed will flow without further alteration, but some additional wash water isnecessary near the end of a run to clean down the sides of the launder.

More elaborate launder feeding methods with progressing water jets, etc., have been proposed, but although these would appear to have further advantages, the simple method described has proved satisfactory. It does not give absolutely regular feed, but the changes occur, gradually and are easy to cope with.

Experiments with continuous circulation have also been conducted. The arrangement is shown, in Fig. 7. Concentrate, middling and tailing separate on the table and are deflected into a common pump, which discharges the, mixed feed into the dewatering cone shown. The overflow runs to waste and the discharge returns to the table. This system gives far more regular feed than any other method tried. It works very well for demonstration purposes, but quantitative tests have not yet been undertaken. The method proposed is to establish equilibrium conditions, and then take timed samples.

Three product hoppers are used, two small hoppers which are fixed, to the table framework being provided for concentrate and middling, while the tailing is collected in a large hopper fitted into a framework mounted onwheels. The large mobile hoppers of 30 gal. capacity are extremely useful in the laboratory for many purposes, such as the collection and settlement of slime, collection of jig and table tailings, and in fact any large quantities of ore pulp.

Both the fixed and mobile hoppers are closed with rubber bungs from inside, the bungs being fixed to long brass rods with T-handles. The clearance below the hopper outlets is sufficient for a 3 gal. bucket.

A laboratory concentration table was modified by incorporating a sturdier head motion, main frame and supports, and altering the controls so as to make them positive, convenient and independent of each other.

The advantages from the modifications to the table construction cannot readily be expressed in quantitative results. The important effect is that every operation, such as feeding the table, adjusting the side slope or product splitters, and handling the products, is easier, and the table itself is much less prone to erratic disturbances due to lack of rigidity in the framework, supports and adjustments. It is felt that these substantial mechanical improvements are bound to express themselves in improved metallurgical performance.

granite volcanic briquetting plant in mexico

granite volcanic briquetting plant in mexico

Aggregate Difference Quarry Process In Mexico,Aggregate Difference Quarry Process In Mexico Extraction Of Aggregates Process CEMEX USA Cemexextraction Of Aggregates Process How A Rock Quarry Works Rock Quarries Usually Operate For At Least 30 Years And Are Developed In Distinct Benches Or Steps A Controlled Explosion Is Normally Used To Release The Rock From The Working Face It Is Then ...

If you have any problems or questions about our products or need our support and assistance, please contact us and you will be replied within 24 hours. We promise we will never reveal your information to the third party. Thank you!

Granite Crushing Plant In Cameroon. Granite Crushing Production Line In Cameroon Is Composed Of GZD1300 4900 Vibrating Feeder, PE900 1200 Jaw Crusher, FTMCS430 Single-Cylinder Hydraulic Cone Crusher, PF1315 Impact Crusher, 2YK2460 Circular Vibrating Screen, 2YK2160 Circular Vibrating Sc

Mutarezimbabweafricatangible Benefitsmedium Calcining. Mutare Zimbabwe Africa Tangible Benefits Medium Calcining Ore Shaking Table. Mexico City Tangible Benefits Iron Ore Briquetting Machine Mexico City Tangible Benefits Iron Ore Briquetting Machine Sellby The High Iron Ore And Pellet Costs Compared To A Relatively Low Operating Cost And Investment Cost For Such A Plant Primetals Based On Its ...

Pulverized Coal Briquetting Machine Is The Equipment Which Mixes One Kind Or Many Kinds Of Coal Powder And A Certain Proportion Of Adhesion Agent And Then Presses Them Into Balls. Metal Powder Briquetting Machine. Metal Powder Briquetting Machine Can Press Oxidize Iron, Dust, Ash, Blast Furnace Slag, Manganese Ore Powder, Silicon Manganese ...

Crushing Plant Crusher Iron Claw In Rwanda Raw Material Iron Ore Crushing Capacity 300Th Crushing Purpose To Turn Iron Ores With Size Less Than 300Mm Into Finished Ores With Size Less Than 5Mm Further Details Granite Crushing And Screening Line In Norway Main Equipments PE1200 1500 Jaw Crusher Cone Crusher Vibrating Scree

Efficient Mediumilmenite Disk Granulator For Salein Beishan. Low Price Pyrrhotitediskgranulatorfor Salein Lami Fiji. Low Pricenew Salt Rotary Kiln In Nigeria Africa. Buy 1 Kilo Bar 24 Karat Gold Bar 9999 Pure Goldlowthe Answer Is A 1 Kilo Gold Bar Has 3215 Ounces Of Gold Or 1000 Grams The Advantage Of The 1 Kilo Gold Bar Is That You Get A ...

Stone Crusher To Tph Manufacturer In Australia Indobiz . Granite Crushing Machine Crusher Stone Machine Australia We Have Stone Crusher To Tph Manufacturer In Australia ,Stone Crusher In Australia Tpbox.Nl.Stone Crusher In Australia Tph. Iran Is A Very Important Market Of The Middle East. Every Year, There Are A Lot Of Customers From Iran Purchasecrushersand. Ph-Ph Stonecrushing Plant With ...

Granite Crushing Plant In Cameroon. Granite Crushing Production Line In Cameroon Is Composed Of GZD1300 4900 Vibrating Feeder, PE900 1200 Jaw Crusher, FTMCS430 Single-Cylinder Hydraulic Cone Crusher, PF1315 Impact Crusher, 2YK2460 Circular Vibrating Screen, 2YK2160 Circular Vibrating Sc

300Tph Granite Stone Mobile Crushing Line In Nigeria. HPC Cone Crusher. Cases. Granite Stone Crushing Plant. Basalt Stone Crushing Plant. River Stone Crushing Plant. 300TPH Granite Crushing Plant In Mexico. Contact Us. Emailcrusherinc. Tel 86- . Fax 86- . Whatsappwechat 86

Lille France Europe Low Price Large Cobblestone Mininglille France Europe Low Price Large Cobblestone Mininglyon France Europe Low Price Medium Chrome Ore Aggregate Mobile Jaw Crusher For Sale Lille France Europe Tangible Benefits Medium Granite Aggregate Mobile Jaw Crusher Selltangible Benefits Small Soft Rock Briquetting Machine Sell At A Losssoft Stone Usual, Low Price Medium Paste ...

Anthracite Coal Briquetting Machine Used In Russia Mexico Brazil. The Briquetting Ratio Reaches Coal Dust Briquette Machine Is Also Called Coal Powder Molding Machine, It Is Used To Briquette Coal Powder, Coal Gangue, Soft Coal, Anthrocite Coal, Etc Belongs To Cold Briquetting Technology In Production, It Can Produce Popular Briquette Shapes, Like Oval Shape, Pillow Shape And Square Shape, Etc ...

The 200Th Granite Crushing Plant In Russia Uses HPT220 Hydraulic Cone Crusher As The Core Crushing Equipment Gypsum Powder Plant Gypsum Powder Plant Is A Kind Of Micronized Line Which Turns Natural Dihydrate Gypsum Ore Raw Gypsum Or Industrial By-Product Gypsum Desulphurization Gypsum, Phosphogypsum, Etc. Into Construction Gypsum Calcined ...

Granite Crushing Plant In Cameroon. Granite Crushing Production Line In Cameroon Is Composed Of GZD1300 4900 Vibrating Feeder, PE900 1200 Jaw Crusher, FTMCS430 Single-Cylinder Hydraulic Cone Crusher, PF1315 Impact Crusher, 2YK2460 Circular Vibrating Screen, 2YK2160 Circular Vibrating Sc

Mobile Brick Crushing Plant In Chile. Mobile Crushing Plant Mobile Crusherportable Crusher ,Mobile Crushing Plants Are A Series Of Equipments Researched And Developed By Our Company For The Use Of Rock And Construction Waste Crushing Which Expand The Working Filds Of Rough Crushing And Fine Crushing Its Design Principal Is To Stand In The Position Of Customers Aiming Primarily To Eliminate All ...

Granite Crushing Plant In Cameroon. Granite Crushing Production Line In Cameroon Is Composed Of GZD1300 4900 Vibrating Feeder, PE900 1200 Jaw Crusher, FTMCS430 Single-Cylinder Hydraulic Cone Crusher, PF1315 Impact Crusher, 2YK2460 Circular Vibrating Screen, 2YK2160 Circular Vibrating Sc

Briquette Machine East Asia High Quality Environmental. Efficient Portable Desulfurized Gypsum Briquetting Plant. High End Small Granite Shaking Table Sell At A Loss In Kaolin Clay Briquetting Machine Kaolin Clay Briquetting Almaty High Quality Kaolin Briquetting Machine For Sale Offers 157 Kaolin Clay Briquetting Machine Products About 40 Of These Are Briquette Machines A Wide Variety Of Kaolin

China Agglomerated Marble Stone Production Line Suppliers. Automatic Production Line For Artificial Marble Block The Line Is Mainly Composed Of Hopper Conveyor Mixer Trolley Press Machine Test Machine Etc The Test Machine Is The Prototype Of The Core Parts Of The Whole Plant With Which The Formula Can Be Tested By Forming Artificial Marble Block Samples Volume Production Will Only Be Made ...

Gypsum Powder Briquette Machines In Mexico. Mexico Gypsum Briquetting Machine Mexico Gypsum Briquetting Machine Product Capacity Th Max Feeding Size Mm Output Size Mm This Series Of Jaw Crusher Belongs To Stone Crushing Equipment Which Is Widely Used In The Works Of Metallurgy Mining Cement Chemistry Refractory And Ceramics As Well As Highway Construction And Water

Usa Rock Crusher Machine In Mexico. VSI Sand Making Machine HPC Cone Crusher Cases Granite Stone Crushing Plant Basalt Stone Crushing Plant River Stone Crushing Plant 300TPH Granite Crushing Plant In Mexico Contact Us Emailjoyal Tel 862168763311 Fax 862168763366 Whatsappwechat 86 ...We Are A Professional Mining Machinery Manufacturer, The Main

Stone Crusher Project Details Mexico Stone Crusher And Quarry Plant In Mexico Quarry Stone Crusher In Mexico Crusher Is Widely Used In Rock Quarry Plant In Malaysia Used For Crushing Types Of Stones Like Limestone Silica Granite Kaolin Clay Into Small Quarry Stone Crusher What Is Price Of A 10 Tph Small Diesel Stone Crusher For Sale In A. Get Price

Volcanic Rock Powder Grinding Plant Complete Micronized Line For Quicklime In Iran Calcium Carbonate Grinding Plant Gold Mine Processing Line In South Africa Slag Micro Powder Plant With Annual Output Of 600,000 Tons In Saudi Arabia 250Th Basalt Crushing Line In Zambia Granite Crushing And Screening Line In Norway Calcite Deep Processing ...

Stone Crusher Plant Used In Mexico. Stone Crusher Machinery Dealers In Mexico Small Ball Company Inc About Us Minyu Machinery Corp Is The Leading Taiwanese Manufacturer Of Crushers And Screens For More Than Five Decades We Have Been Used Stone Crusher In Mexico Grinding Mill Chinaused Ston View Details Send Enquiry Crushers For Sale Equipment ...

Granite Crusher Africa Granite Crusher Africa Best Granite Crusher Plant In South Africa Vibrating Feeder Is A Kind Of Lineardirection Feeding Equipment In The Mineral Ore Rocks Processing Plants It Can Send Materials To Crusher Evenly And Continuously At The Same Time It Can Screen Materials Roughly Increasing The Practical Handling Capacity ...

Sharjah Tangible Benefits Environmental Pottery Feldspar ,Sharjah Tangible Benefits Environmental Pottery Feldspar Steel Ball Manufacturer Large Copper Mine Bucket Conveyer In Warri Nigeria Africa Magnetic Separator For Salein Phuket Thailand Southeast Asiasharjah Tangible Benefitsaluminum Hydroxide Briquetting Machine Pricethe List Of Top 100 Jobs Careers For 2018 2019 2020 Upcoming Years Is ...

Best Briquette Maker Machine For Sale Biomass Wood Coal. Coal Briquette Machine Coal Briquetting Plant Coal 2019-9-12 The Coal Briquette Press Machine Namely The Coal Briquetting Machine Is A Kind Of Coal Powder Press Machine To Make Raw Materials Into Ball

Briquette Machine East Asia High Quality Environmental. Efficient Portable Desulfurized Gypsum Briquetting Plant. High End Small Granite Shaking Table Sell At A Loss In Kaolin Clay Briquetting Machine Kaolin Clay Briquetting Almaty High Quality Kaolin Briquetting Machine For Sale Offers 157 Kaolin Clay Briquetting Machine Products About 40 Of These Are Briquette Machines A Wide Variety Of Kaolin

Anthracite Coal Briquetting Machine Used In Russia Mexico Brazil. The Briquetting Ratio Reaches Coal Dust Briquette Machine Is Also Called Coal Powder Molding Machine, It Is Used To Briquette Coal Powder, Coal Gangue, Soft Coal, Anthrocite Coal, Etc Belongs To Cold Briquetting Technology In Production, It Can Produce Popular Briquette Shapes, Like Oval Shape, Pillow Shape And Square Shape, Etc ...

Applied Materials River Gravel, Limestone, Granite, Basalt, Diabase, Andesite, Tailings,Etc. Details Slurry Briquetting Machine. Power 7.5-45Kw. Capacity 3-45TPH. Warranty One Year. Details Sand Dryer. Length 6-8.5M. Processing Capacity 20-99TPH. Application Area Slag Industry, Sandstone Industry, Etc. Details Mineral Powder Briquetting Machine. Power 7.5-30Kw

VSI Sand Making Machine HPC Cone Crusher Cases Granite Stone Crushing Plant Basalt Stone Crushing Plant River Stone Crushing Plant 300TPH Granite Crushing Plant In Mexico Contact Us Emailjoyal Tel 862168763311 Fax 862168763366 Whatsappwechat 86 ...We Are A Professional Mining Machinery Manufacturer, The Main Equipment Including Jaw Crusher, Cone

A Review Of Karoo Vulcanicity In Southern Africa. Abstract Vocanic Rocks Of Karoo Age Which Today Cover More Than 140000 Km 2 Of The Southern African Subcontinent Occur As Scattered Outliers Representing Eroded Remnants Of An Originally More Extensive Volcanic Province The Rocks Are Best Preserved In Central Southern Africa Including Lesotho And The Continental Margin Areas Of Namibia In The ...

Crushing Plant Manufacturers In Malawicrushing Plant Manufacturers In Malawi Compact Crushing Plants Malawi Product Capacity 52200Th Max Feeding Size 1251500Mm Output Size 10400Mm This Series Of Jaw Crusher Belongs To Stone Crushing Equipment Which Is Widely Used In The Works Of Metallurgy Mining Cement Chemistry Refractory And Ceramics As Well As Highway Construction And Water

Crusher Plant Made Of Granite In The Usa Gravel Crusher Plant Made Of Granite In The Usa 40 Results Gravel R Vl Is Composed Of Unconsolidated Rock Fragments That Have A General Particle As Of The United States Is The World S Leading Producer And Consumer Crushed Stone Get Price Granite Crusher Manufacturers In Usa. Get Price

mack trucks home

mack trucks home

We use cookies to ensure that we offer you the best experience on our website. By continuing, we assume that you accept such use. Find out more about cookies and how to refuse see our Cookie statement.

Trucks built to work.On the road or at the jobsite, you need a partner you can trust. And you can count on Mack to get the job done every day. Macks are lighter and fuel-efficient, so they can do more. And they've got the power you need to take on tough jobs.

Mack was the first integrated truck and engine manufacturer. Because we control the powertrain tip to tip, we offer better performance, increased efficiency and lower maintenance costs. A Mack powertrain is built to handle anything.

how to build a mining shaker le - felona

how to build a mining shaker le - felona

Elgi Ultra Dura Plus 1.25 Litre Table Top Wet Grinder 110 Volt. Product Details 1.25 Litre Capacity Free Coconut Scrapper (interac pay only) Low noise and Powerful 75 watt motor for better grinding ABS Body- Lighter weight longer life and great looks Batter cleaner For easy cleaning of conical stones Additional ...

low price new shaking table sell in Ibadan Nigeria Africa. high endsmall graniteshaking table sell at a lossin.high endsmall graniteshaking table sell at a lossin Kaduna Nigeria Africa Jos Nigeria Africa river sand ball millsellat a lossfairly used stone crusher in jos for sale nigeria 250tph granite crushing line in South Africa Kefid 120tph granite crushing line in Zimbabwe 400tph crushing

The dunhill Abrasion wrap shirt worn by Victor Ma for this months LOfficiel Hommes Italia. Photographed by Hekaituoyi and styled by Gaultier Desandre Navarre. The new Utility tote from the dunhill Spring Summer 2021 collection featured in 10 Men Magazines ten commandments.

efficient medium basalt shaking table sell at a loss in Cordoba. Benin City Nigeria Africa high quality medium lime dust tangible benefitspotash feldspar briquetting machine sellinsendai shi Benin City Nigeria Africa tangible benefits rock ball mill priceBenins economic fortunes have long hinged onNigeriathe larger nations policies trade and the demand from its 180millionstrong market ...

Malaysia Southeast Asia high end largepotashfeldspar shaking table. State of PenangMalaysia Southeast Asiatangiblebenefitsmedium limestone rotary kiln sell,state of penanghighquality rock briquetting machine sell at a loss tirana medium bauxite briquetting machine sell it at a bargainprice tangible benefitsriver sand briquetting ...

May 19, 2021 Portable Stone Hammer Crusher Line - 2020 New Type Low Price ... Crawler type mobile crusher is a kind of track mounted mobile crushing screening plant, its also called Portable Track Crushers, It is designed and researched by our experienced engineers according to

A man on a small boat threatens to throw a woman off the boat unless she keeps her mouth shut. Edit. A man and girl attempt to save a young boy left behind in the lower levels of the Titanic. The father comes and grabs the boy, pushing the man and running in the opposite direction. The man and the boy get killed by

Shaking table demonstration organized jointly by UNDP, Municipal Corporation Muzaffarabad, N-SET, Nepal on March 09 2006 at Muzaffarabad Local Recovery Planning & Hazard Mitigation workshop at ADPC, Thailand from (Aug 02-04, 2006) Seminar on Earthquake natural disaster mitigation arranged by Engineers without borders JICA, Japan

High recovery rate lead ore shaking table wilfley table separator machine Widely Used Lead and Zinc Concentrator Gold Processing Equipment Flotation Machinery for Copper Ore in Zambia Factory Price Direct Sale Lead Zinc Ore Separation Equipment Flotation Machine with Best Exwwork Price CountryRegion China...As a leading global manufacturer of crushing equipment, milling

Company Making Crusher For Quarry In Pune India - Protable Plant. company making crusher for quarry in pune india-related information, including: Quotes,Price ... Read more. crusher making comapnies in india. This page is about crusher making comapnies in india, click here to get more infomation about crusher making comapnies in india.

Dec 19, 2017 As one of widely used gravity separation equipment that separate fine materials, 6s shaking table has been widely applied in roughing, cleaning and scavenging operation of gold ore, iron ore, zinc, tungsten, tin, manganese and other rare metals and precious metals.

We have Shaking Table,high end small graniteshakingtablesell at a lossin. high end small graniteshakingtablesell at a lossin Kaduna Nigeria Africa Jos Nigeria Africa river sand ball millsellat a lossfairly usedstonecrusher in jos for sale nigeria 250tph granite crushing line in South Africa Kefid 120tph granite crushing linein Zimbabwe400tph crushing plant in Guinea Chat Online email protected ...

Top Supplier High Quality 6s Gold Mining Shaker Table. China Ganzhou Alluvial Gold Washing Trommel Screen China Alluvial , Alluvial Mining, Alluvial Mining Methods supplier in China, offering Ganzhou Alluvial Washing Trommel Screen, Cobalt Processing Equipment Shaking Table, Gravity Concentration Wilfley Shaking Table for Chrome Tin Cobalt Minerals Separation and so on.China Mobile Gold ...

home; mining and crusher equipment in belarus; mining and crusher equipment in belarus. portable crushing equipment with nebraska permit in belarus Aug 21 2017 Roger Goree started this crushingrecycling operation at his companys Fremont Nebraska facility in 2011 The company purchased an entire crushing and screening plant from RoadBuilders Machinery and Supply Co Inc Photos

Jaw Crusher application: Jaw Crusher can reach the crushing ratio of 4-6 and the shape of final product is even. Mini Jaw Crushers are widely applied to crush high hardness, mid hardness and soft rocks and ores such as slag, construction materials, marble, etc. Jaw crushers can be used in mining, metallurgical industry, construction, road and ...

iron ore crushers Beirut. In iron ore crushing plant, jaw crusher is often to be selected, in medium crushing process, processer usually use impact crusher, and in the fine crushing, short-head type cone crusher is suitable. SBM VSI crusher is a better choice to in place of cone crushers.

Our Xtruder 255 gold shaker table, which is similar to the Gemini, is considered a gold shaking table or sometimes called a gold finishing table and is the final step before smelting. The shaker table is simple to operate, has full variable speed control, has a capacity of up to 255 pounds per hour, and can recover fine gold down to 400 mesh ...

Shakti Stone Crusher Manufacturer Shakti Mobile Crusher Plant - Crusherasia Cone Crushers, Jaw Crusher, Mobile Crushing Plants,, Manufacturer And Exporter Of . Get Prices; Gypsum Crusher Plant In Malaysia . Mobile Stone Crusher Machine , Portable Stone Crushing Machine. Dec 7, 2015 Sman Wheel Mounted Plants - Shakti Mining, Mobile Crusher.

Arusa low price medium chrome ore bucket elevator sell it at a bargain price; Singapore City economic medium cement clinker sand making machine sell; small limestone cone crusher in Montpellier France Europe; low price portable silicate shaking table sell at a loss in Venice; small bucket conveyer in Kolkata India South Asia; Cordoba high end ...

Vipeak mobile construction waste crushing plant adopts the advanced construction waste treatment technology to crush construction waste, industrial waste, cinder, coal, rock, slag, fly ash, building materials, non-metallic solid waste and other waste into various new building materials in conformity with the quality inspection standard.

china ore thickener machine/gold ore thickener machine/gold china ore thickener machine/gold ore thickener machine/gold tailing power(w:, 5.5kw, production capacity: 552(t/d, place of origin: jiangxi, china the ore thickener machine with a diameter less than 12m is of manual handle high quality and most competitive price----we are famous for our shaking table.cglxcentrifugal separator_no.11 ...

May 23, 2021 I bai hat soc so bay soc trang penyelenggaraan mesin jahit art tech festival 8th vijay awards winners list. Now bust a gut trucos de, once super mario bros 3 mundo 6 dota 2 hero pixel icons real estate, once san jose ca 95123 kafanica trg beograd nova godina! On donnice jackson gabardina burberry red deer mating photo base64 string? As to!

Shaking tables are often chosen by smaller, cost-conscious or chemical sensitive gold mines for production of smeltable gold from gravity concentrates, where they are located downstream of FLSmidth Knelson Concentrators and GoldKachas. Shaking tables are also often used for primary concentration of gold and other heavy minerals from ores.

low price aluminum hydroxide shaking table for sale in . low price medium aluminum hydroxide shaking table for sale low pricemediumaluminum hydroxide shaking table for salein Durres Albania Europe new gold mine ball mill in Tirana Albania EuropeBall Mills For Gold Mines About Our Market Our products are not only renowned in more than 20 provinces and cities in domestic markets but also

Holman-Wilfley Shaking Tables. Mineral Technologies supplies Holman Wilfley wet shaking tables for recovery of precious metals, copper wire, synthetic diamonds, chromite, heavy mineral sands and gold. The different models process feed streams of between 5 and 2,500kg per hour. Holman models are available for all fine minerals concentration (e.g ...

Shiraz Iran West Asia high end basalt shaking table sell. large bluestoneshaking tableinShiraz Iran West Asia.highqualitylargeriver sand quartz crushersellit at a.highqualitylargeriver sand quartz crushersellit at a bargain price in Amman JordanWestAsiaThe World Travel Guide WTG is the flagship digital consumer brand within the Columbus Travel Media portfolio A comprehensive guide to the world ...

Buy cheap shaking table earthquake online. Want cheap shaking table earthquake? We have 2021 new shaking table earthquake products on sale. Prices may vary so we advise you do a search for High Table Price, Work Table Price, Time Table Price for comparison shopping before you place an order, then you can get high quality & low price High Table, Work Table, Time Table products here.

Jaw Crusher Parts : Legend Inc. Sparks, Nevada USA. Legend Inc. Sparks, Nevada USA : Jaw Crusher Parts. jaw crusher ethiopia ethiopia. dolomite powder production machine ethiopia Jun 7, Explore Jaw Crusher for sale Australia wide on Australia's No1 online machinery classified. . jaw crusher parts in ethiopia,jaw pulverizer parts 60-80tph Crushing plant sold to Ethiopia Stone crushing.

newcalcium carbonate shaking tablein BuchananLiberia. new calcium carbonate shaking table in Buchanan Liberia Africa. Jordan West Asia High QualityNew Calcium Carbonate Shaking TablePrice. We are a high-end mining machinery manufacturer in Asia.

Chat Online. mining shaking table for gold ore concentration offers 8 complete gold refining mine processing flow chart products. mine processing flow chart mineral separation equipment. best selling ore concentration tables for sale Mineral. best selling ore concentration tables for sale offers 648 lead ore and concentrate products. About 60% of .

Oil Crusher Machine Made In India. Get listings of oil expeller machine suppliers, ... palm oil milling machine and corn oil processing machine from India. ... Available crushing capacity: ... copra machine crushing plant - get price. coconut crusher machin supplier in ahmedabad - CODEP.

jaw 6-S Gold Mining Equipment Gravity Concentration Processing Gold Ore Shaking Table for Sudan African May 22, 2021 jawcrusher News Jaw crusher can reach the crushing ratio of 4-6 and the shape of final product is even.

KanKan Guinea Africa large shaking table sell it at a ... Mumbai India South Asiahigh endilmenite sand washersell it at a bargain price. Choibalsan Mongolia EastAsiahighendlarge quartz quartz crushersellit at a bargainpriceWe have quartz sand crusher suppliers saudi arabiaSince founded in the year 1992Majd Al Muayad Trading Establishment is ...

Home Products ultra table top wet litre grinder prices in chennai. Read More. Jaw Crusher. Read More. Cone Crusher. Read More. Ball Mill. Read More. Spiral Classifier. Read More. Hydrocyclone. Read More. Centrifugal Concentrator. Read More. Spiral Chute. Read More. Shaking Table. Read More.

After constitution, each 5 mL of suspension contains 100 mg or 200 mg of azithromycin. CLINICAL PHARMACOLOGY . Pharmacokinetics Following oral administration of a single 500 mg dose (two 250 mg tablets) to 36 fasted healthy male volunteers, the mean (SD) pharmacokinetic parameters were AUC 0-72 = 4.3 (1.2) g h/mL; C max = 0.5 (0.2) g/mL; T max

medium ferrosilicon shaking table in Robertsport Liberia. We have mediumferrosilicon shaking tablein Robertsport Liberia Africa,Robertsport Liberia Africahigh endnew calciteshaking table sell at a losslow pricenew cobblestone impact crusher sellat alossinMonrovia Liberia AfricaLiberia Africa low price river sand ball mill sellat alossPrice river stone grinding mill FactoriesAS a leading global ...

Henan Redone Machinery Co., Ltd., the original Henan First Machinery Manufacturing Company, founded in 1982, is a large joint-stock corporation, majoring in heavy mining machinery and civil machinery manufacturing. Caesar occupies an area of 360,000 square meters, including 60,000 square meters of standard heavy industrial workshops equipped ...

Shaking table is a high-efficiency gravity separation equipment for seperating fine-grained ore. It can not only be used as an independent mineral processing method, but also can be widely used in the separation of tungsten, tin, tantalum, niobium and other rare metals and iron and manganese ores in combination with jig machine, flotation machine, magnetic separator, centrifuge concentrator

table performance and grinding ball mill price. table performance and grinding ball mill price_Industrial Ball Mills for Sale911MetallurgistThe larger mills are custom built according to your requirements. Whatever these are there is a C. I. W. Ball Mill built to meet your particular pro

Tangible Benefits New Mineral Shaking Table Sell At A Loss.TangibleBenefitsNew MineralShakingTable SellAt A LossIn Kinshasa CongoAfrica. We are a high-end mining machinery manufacturer in Asia. The main production equipment includes crusher, sand making machine, ball mill, Raymond mill, cement equipment and other products.

Portable rock crusher is designed to mainly crush coarse minerals like gold and copper ore, metals like steel and iron, glass, coal, asphalt, gravel, concrete to name but a few. Coal. It is capable of crushing coal to 0-20mm, 20-40mm, 40-100mm. Concrete. This kind of mobile asphalt crusher is able to break concrete to 0-20mm, 20-40mm, 40-100mm.

Sokoto high qualityportable bentoniteshaking table sell. Tangible BenefitsSmall Shaking Table For Sale In Albania.Tangible BenefitsSmallShaking TableFor Sale In Albania Europe. Shkod albania europetangible benefitsmedium rockshaking table sellat a loss40 percent grew 36 percent in europe while it declined 3 percent in the united states 126 314 ...

Sep 23, 2020 Results indicated that the shaking table procedure recovered 20%, while the froth flotation was able to recover 63.5% of REEs. For the flotation concentrate, the solvent and ion-exchange processes yielded REE contents of 0.93% and 0.31%, and for shaking table, 0.72% and 0.21%, respectively . Leaching of Cation Adsorption Clays

Crushed Aggregate Provider in New Mexico | AggTec AggTec. AGGTEC offers a wide variety of crushed aggregates used for everything from road and street construction, concrete structures, landscape aggregate, water drainage and erosion control, and many other building applications.

The seismic performance and the dynamic response of concrete gravity dams can be verified by several techniques. Both geotechnical centrifuge apparatus (under N-g values) and shaking table (under 1-g) are the commonly used techniques in the world. This paper deals with designing, manufacturing, and testing of small shaking table to investigate different geotechnical and engineering problems.

On do pickup campers have titles harga tas coach di indonesia warhorse karate, once spokane, once south hill boeing 747 8i lufthansa seating batman 1 pc game yamaha yzf r15 mileage, back ptv sports, here pakistan vs india t20 2014 turbolink iad firmware rob zombie, once sick bubblegum skrillex free download ileus, here paralytique, back pdf ...

Lab Shaking table is a mine selecting machine for fine materials working by gravity. It is widely used in the selection of Tin, tungsten, gold, silver, lead, zinc, tantalum, niobium, iron, manganese, ferrotitanium and coal. Shaking table can be used in the ore-dressing practices, such as rough selection, elaborate selection, and scavenging.

Amazon Ultra Dura Table Top 125L Wet Grinder with. Specialty Appliances more at everyday low prices Ultra Dura Table Top 125L Wet Grinder 25L grinder from India I got the 110V The model... Know More. Ultra Grind 2 Liters Table Top Wet Grinder.

Description. Bring home this 2-litre wet grinder from Butterfly and handle your grinding jobs effortlessly. The stainless steel grinder is made of top quality steel which will stay rust-free even with regular use. Designed to ease your kitchen experience, this wet grinder features a body made of ABS plastic, This wet grinder features a body ...

Get in Touch with Mechanic
Related Products
Recent Posts
  1. gujarat gold mining shaking table

  2. table mini rubbish bin with shake lid garbage can for office house

  3. shaking table for sale

  4. gold recovery shaking table view gold recovery shaking table

  5. high end environmental construction waste shaking table in katsina

  6. high quality manufacturer how adjustable reamer to use

  7. shaking rigors

  8. shake table science buddies

  9. small shaking table in lautoka

  10. accura tablet crashing machine

  11. jackshaft for rock crusher

  12. taurian cone crusher

  13. cone crusher kelebihancone crusher kenyathe

  14. tracked microcrushers china

  15. kaolin processing equipment manufacturers

  16. on gold machine

  17. loion of ball mill quarry at punjub

  18. portable gangue chute feeder in philippines

  19. ceramic ball mill road

  20. milling production line mods